Octamer Study guides, Revision notes & Summaries

Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...

Step 1 First Aid - Biochemistry Chromatin structure Answer- Negatively charged DNA loops twice around histone octamer (2 each of the positively charged H2A, H2B, H3, and H4) to form nucleosome bead. H1 ties nucleosomes together in a string. (Think of "beads on a string"; H1 is the only histone that is not in the nucleosome core.) In mitosis, DNA condenses to form mitotic chromosomes. <img src="66a - Euchramatin strxr.JPG" /> Heterochromatin Answer- Condensed, transcriptiona...

Understand the storage of genetic information and how it is passed down to successive generations and the principles of basic techniques in molecular biology This is the direction that both bacteria and human DNA use in Replication correct answer: Bidirectional synthesis This contains the plasma membrane, DNA, the cell wall, flagellum, and ribosomes in the cell correct answer: The Prokaryote Genome This is circular in bacteria cells, attached to the plasma membrane, and can include a ...

DNA is more suitable than RNA to serve as genetic material. One reason is: - Answer- DNA is a much more stable molecule due to the lack of 2'-OH group on the sugar component common form of DNA double helix has phosphodiester bonds that--- - Answer- between nucleotide residues run in opposite directions in the two strands B-form DNA - Answer- most stable form under physiological conditions, wide and deep major groove, with base-pairs nearly perpendicular to the axis of the helix binding...

Describe the structure of a prokaryotic (bacterial) genome correct answer: 1. Circular in bacterial cells, 2. attached to the plasma membrane, 3. Can include a separate DNA fragment (plasmid DNA) What shape are plasmids? correct answer: Also circular What are 2 properties of plasmids? correct answer: 1. Can carry antiobiotic resistance, 2. Can be transferred between bacteria How many DNA molecules are in a human chromosome/genome? correct answer: 1 single DNA molecule What is chr...

GCD Exam 2 Practice Test Comp 86 Questions (chp 9-13) with Verified Answers Which of the following could be the components of a single nucleotide found in DNA? a. Ribose, phosphate, and cytosine b. Deoxyribose, phosphate, and uracil c. Deoxyribose, phosphate, and adenine d. Ribose, phosphate, and uracil - CORRECT ANSWER c. Deoxyribose, phosphate, and adenine 2. Which of the following is NOT a feature of the DNA double helix? a. It obeys the AG/TC rule. b. There are 10 nucleotides...

MB ASCP Study Questions (1) Questions and Answered 100% correct Which of the following terms refers to the proportion of individuals affected by an autosomal dominant condition that displays manifestations? A. codominance B. penetrance C. expressivity D. influence E. passivity Answer Key: B penetrance Feedback: Certain autosomal dominant conditions are variably expressed due to differences in penetrance and expressivity. Penetrance refers to how people with the genetic abnormality mani...

Which of the following terms refers to the proportion of individuals affected by an autosomal dominant condition that displays manifestations? A. codominance B. penetrance C. expressivity D. influence E. passivity Answer Key: B penetrance Feedback: Certain autosomal dominant conditions are variably expressed due to differences in penetrance and expressivity. Penetrance refers to how people with the genetic abnormality manifest disease, and expressivity refers to how severe those manifes...

AAB Molecular Diagnostics Basic DNA Exam Question and Answers 2024

Metabolic processes can be turned "on" and "off" by chemical modifcation. Which chemical modification do we associate with changing the activity of an enzyme in a transient/non-permanent manner? Phosphorylation After transcription, nuclear RNA is capped, polyadenylated, spliced. After successful splicing, proteins are added to the mature mRNA at the exon junction complex and then transported to the cytoplasm. Which of the following is a NOT a reason why these modifications are add...