Written by students who passed Immediately available after payment Read online or as PDF Wrong document? Swap it for free 4.6 TrustPilot
logo-home
Document preview thumbnail
Preview 4 out of 38 pages
Exam (elaborations)

Cell & Molecular Biology (BIOL 300) Actual Exam 2 Notes to Pass Your Exam (2025–2026) | Virginia Commonwealth University

Document preview thumbnail
Preview 4 out of 38 pages

Thorough and exam-focused notes for BIOL 300 (Cell & Molecular Biology) Exam 2 at Virginia Commonwealth University. Topics include the central dogma of molecular biology, DNA structure and base pairing, chromosomes and chromatin organization, replication, nucleosomes, histones, chromatin remodeling, epigenetics, and visualizing DNA through FISH and staining. Clearly structured with diagrams and examples to support deep understanding and high exam performance.

Content preview

CELL & MOLECULAR BIOLOGY (BIOL 300)
ACTUAL EXAM 2 NOTES TO PASS YOUR
EXAM (2025-2026) VIRGINIA
COMMONWEALTH UNIVERSITY

,Exam 2:
DNA and Chromosomes
A. The central dogma of molecular biology ‘The flow of genetic material’
a. DNA
i. Information storage “the hard Drive”
ii. DNA synthesis r5
1. Replication
b. RNA
i. Temporary message “the cache”
ii. RNA synthesis
1. Transcription
c. Protein
i. Functional units “the programs”
ii. Protein synthesis
1. Translation
B. The instructions for life
a. Deoxyribonucleic acid (DNA)
i. Recognized in 1940’s as likely carrier genetic information
ii. Structure determined in 1953 by Watson and Crick with the help of
Rosalind Franklin and Charagaffnn
iii. DNA is polymer
b. Nucleotides: building blocks of DNA
i. Nucleotides covalently linked by phosphodiester linkage to form
polynucleotide chains (DNA strands)
1. Repeating: sugar-phosphate-sugar-phosphate
a. G= Guanine
b. A= Adenine
c. C=Cytosine
d. T=Thymine
ii. The structure of DNA:
https://www.youtube.com/watch?v=o_-6JXLYS-k
iii. Building blocks of DNA
1. Sugar-phosphate covalently linked to a base
c. Complementary base pairings
i. Held together by hydrogen bonds between paired bases
1. Always paired together
a. A-T (adenine-thymine)
b. G-C (guanine-cytosine)
ii. DNA strands run antiparallel
1. 5’ phosphate

, 2. 3’ hydroxyl
iii. Complementary base pairing
d. Hydrogen bonds between strands
i. Between A&T: 2 bonds
1. Tata boxes are made of A&Ts. They're easy to break because the
only have 2 hydrogen bond
ii. Between G&C: 3 bonds
iii. ONLY fits if strands run ANTIparallel (One strand 5’ to 3’ and the other
3’ to 5’)
e. Twisted helix
i. Right- handed helix
ii. 10 base pairs per helical turn
iii. Major groove- wider
1. More action
iv. Minor groove- smaller
1. Less action
f. Complement
i. What is the complement?
1. 5’ ATTGCATCGTGTGCAATCGTATC 3’
2. 3’ TAACGTAGCACACGTTAGCATAG 5’
a. If you know what one strand looks like you will know the
other
b. C to G and A to T; allows each strands to be copied during
replication
C. Chromosomes: how the data is stored
a. Bacteria
i. Single, circular DNA molecule
b. Eukaryotic cells
i. Long double stranded DNA packaged into chromosomes
1. Chromosomes are linear
c. Human cell contains 2 m (6ft) of DNA but the cell nucleus is 5-8 𝛍m in diameter
D. Eukaryotic (Human) DNA
a. Human genome
i. 3.2*10^9 (billion) nucleotides on 23 pairs of chromosomes
1. 22 autosomes and one pair of sex chromosomes
b. Each cell has 46 single chromosomes
c. Each chromosome is a single, long DNA molecule
d. 2 similar copies of each chromosome
i. Homologous chromosomes
1. Homologs: same genes, different alleles

, 2. 22 pairs in each cell
ii. Chroma (greek)= color
e. Non Homologous pair
i. Sex chromosomes XX or XY girl XX boy XY
1. One pair in each cell
E. Chromosomes contain our genes
a. The functional units of heredity
i. What is a gene?: https://www.youtube.com/watch?v=5MQdXjRPHmQ
1. What is a gene?
a. A special stretch of DNA: a sequence of A,C,T,G’s that
codes for something
b. Contains information for a cell to read
2. What do those codes do
a. Genes make protein, that build things
3. Size matters ( °͡ ʖ͜ °͡)
a. Genes can range from 300- million letters long
b. The length and sequence of a gene determine the size and
shape of the protein it builds.
c. That size and shape of protein determines the function that
protein will have.
4. Many creatures share the same genes
a. Humans and chimps share over 96% of their genetic code
5. All genes are written in the same basic DNA language
a. A,C,T, and G’s
ii. Intragenic* means DNA between the genes or “junk DNA”
b. Region of DNA, responsible for specifying a single protein or RNA molecule
c. Also contains large regions of noncoding DNA
i. Often referred to as “junk DNA”
1. Now known to be involved in the regulation of our genes
d. The organization of genes on a human chromosome
i. Grey regions are the intragenic




ii.

Document information

Uploaded on
July 23, 2025
Number of pages
38
Written in
2024/2025
Type
Exam (elaborations)
Contains
Questions & answers
$19.49

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
saraciousstuvia
4.0
(118)
Sold
572
Followers
380
Items
11322
Last sold
1 month ago




Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions