MB ASCP CONNECT EXAM /ACTUAL EXAM QUESTIONS AND
MB ASCP CONNECT
CORRECT ANSWERS WITH RATIONALES(100% VERIFIED
Study online at https://quizlet.com/_fah5x1
ANSWERS)|ALREADY GRADED A+/NEWEST UPDATE
1. What is translocation is associated with Burkitt's Lym- t(8; 14)
phoma?
TIP: Burkkitt's 8 letters,
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)
2. Locus PF Child Paternity Index 92.5 %
LOC-A1 3 2/3 2.18 Multiply all PI together =
LOC-B2 7/5 5 0.798 CPI
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37 (CPI x PP) / [CPI x P + (1 -
PP)
Based on the data presented in the table above and OR ...
with a prior probability (PP) of 0.5, the probability of CPI / (1 + CPI)
paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5%
3. You have sequenced a gene and observe the follow- Frame-shift mutation
ing:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation
4. Which of the following is not involved in the splicing Hairpin loops
reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site
5. Which of the following statements are characteristics At the melting point, the
of the melt curve analysis? (hint: more than one an- probe separates from the
swer) target strand and fluores-
cence rapidly decreases.
a. At the melting point, the probe separates from the
target strand and fluorescence rapidly decreases. The melting temperature
b. The melting temperature of double stranded DNA of double stranded DNA
depends on its base composition and length. depends on its base com-
c. All PCR products for a specific primer pair should position and length.
have the same melting temperature.
d. When hybridization probes are utilized, the temper- All PCR products for a spe-
ature is incrementally decreased while fluorescence is cific primer pair should
monitored. have the same melting
temperature.
6. In the field of molecular diagnostics, which one of Proto-oncogenes
the following genes is responsible for the synthesis of
DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes
7. Microsatellite instability is best described as: Contraction or expansion
of the genome caused
a. The ability of a gene with repeating elements of 8-10 by frameshift mutations
base pairs to randomly mutate (deletions or insertions) in
b. Contraction or expansion of the genome caused elements of the genome
by frameshift mutations (deletions or insertions) in consisting of a repeat-
elements of the genome consisting of a repeating ing sequence of 1-3 base
sequence of 1-3 base pairs pairs
c. Repetitive elements in the genome with the ability
to self-prime, thus creating additional copies of genet-
ic material at the allele loci
d. Random gene rearrangement between repeating
elements of the same size on different chromosomes
resulting in different size gene products
8. Purines and pyrimidines differ from each other in Purines have two rings;
that: pyrimidines have one
ring
a. Purines are found RNA; pyrimidines are found in
DNA TIP: Reciprocals of each
b. There's no difference between purines and pyrim- other.
idines Purine, shorter word,
c. Pyrimidines have two rings; purines have one ring longer rings.
d. Purines have two rings; pyrimidines have one ring Pyrimidine, longer word,
shorter ring.
9. Which of the following molecular methodologies Variable number tandem
would be the best for detecting a trinucleotide repeat repeat analysis
disorder such as Huntington's disease?
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR
10. Locus Test C M PF1 PF2 Neither
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6
Based on the results above, which one of the two pos-
sible fathers is the two-month old's biological father?
a. Possible Father 1
b. Possible Father 2
c. Neither of the Possible Fathers
11. Sickle cell disease is an autosomal genetic disease due Pleiotrophy
to a point mutation in the beta-globin gene, where
glutamic acid is substituted for valine at the sixth
codon of the gene, resulting in a faulty hemoglobin
S (Hb S). Sickle cell disease is one of many genetic
diseases where a single gene controls the expression
of many phenotypic traits. The phenomenon where a
single gene controls the expression of many pheno-
typic traits is best referred to as:
a. Pleiotrophy
b. Polygenic inheritance
MB ASCP CONNECT
CORRECT ANSWERS WITH RATIONALES(100% VERIFIED
Study online at https://quizlet.com/_fah5x1
ANSWERS)|ALREADY GRADED A+/NEWEST UPDATE
1. What is translocation is associated with Burkitt's Lym- t(8; 14)
phoma?
TIP: Burkkitt's 8 letters,
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17)
2. Locus PF Child Paternity Index 92.5 %
LOC-A1 3 2/3 2.18 Multiply all PI together =
LOC-B2 7/5 5 0.798 CPI
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37 (CPI x PP) / [CPI x P + (1 -
PP)
Based on the data presented in the table above and OR ...
with a prior probability (PP) of 0.5, the probability of CPI / (1 + CPI)
paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5%
3. You have sequenced a gene and observe the follow- Frame-shift mutation
ing:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation
4. Which of the following is not involved in the splicing Hairpin loops
reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site
5. Which of the following statements are characteristics At the melting point, the
of the melt curve analysis? (hint: more than one an- probe separates from the
swer) target strand and fluores-
cence rapidly decreases.
a. At the melting point, the probe separates from the
target strand and fluorescence rapidly decreases. The melting temperature
b. The melting temperature of double stranded DNA of double stranded DNA
depends on its base composition and length. depends on its base com-
c. All PCR products for a specific primer pair should position and length.
have the same melting temperature.
d. When hybridization probes are utilized, the temper- All PCR products for a spe-
ature is incrementally decreased while fluorescence is cific primer pair should
monitored. have the same melting
temperature.
6. In the field of molecular diagnostics, which one of Proto-oncogenes
the following genes is responsible for the synthesis of
DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes
7. Microsatellite instability is best described as: Contraction or expansion
of the genome caused
a. The ability of a gene with repeating elements of 8-10 by frameshift mutations
base pairs to randomly mutate (deletions or insertions) in
b. Contraction or expansion of the genome caused elements of the genome
by frameshift mutations (deletions or insertions) in consisting of a repeat-
elements of the genome consisting of a repeating ing sequence of 1-3 base
sequence of 1-3 base pairs pairs
c. Repetitive elements in the genome with the ability
to self-prime, thus creating additional copies of genet-
ic material at the allele loci
d. Random gene rearrangement between repeating
elements of the same size on different chromosomes
resulting in different size gene products
8. Purines and pyrimidines differ from each other in Purines have two rings;
that: pyrimidines have one
ring
a. Purines are found RNA; pyrimidines are found in
DNA TIP: Reciprocals of each
b. There's no difference between purines and pyrim- other.
idines Purine, shorter word,
c. Pyrimidines have two rings; purines have one ring longer rings.
d. Purines have two rings; pyrimidines have one ring Pyrimidine, longer word,
shorter ring.
9. Which of the following molecular methodologies Variable number tandem
would be the best for detecting a trinucleotide repeat repeat analysis
disorder such as Huntington's disease?
, MB ASCP CONNECT
Study online at https://quizlet.com/_fah5x1
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR
10. Locus Test C M PF1 PF2 Neither
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6
Based on the results above, which one of the two pos-
sible fathers is the two-month old's biological father?
a. Possible Father 1
b. Possible Father 2
c. Neither of the Possible Fathers
11. Sickle cell disease is an autosomal genetic disease due Pleiotrophy
to a point mutation in the beta-globin gene, where
glutamic acid is substituted for valine at the sixth
codon of the gene, resulting in a faulty hemoglobin
S (Hb S). Sickle cell disease is one of many genetic
diseases where a single gene controls the expression
of many phenotypic traits. The phenomenon where a
single gene controls the expression of many pheno-
typic traits is best referred to as:
a. Pleiotrophy
b. Polygenic inheritance
