• Wrong document? Swap it for free
  • Written by students who passed
  • Immediately available after payment
  • Read online or as PDF
Sell
Where do you study
Your language
Document preview thumbnail
Preview 1 out of 4 pages
Exam (elaborations)

MLS EXAM 3 QUESTIONS & ANSWERS 2024/2025

Document preview thumbnail
Preview 1 out of 4 pages

MLS EXAM 3 QUESTIONS & ANSWERS 2024/2025 A functional human chromosome must include which of the following? - ANSWERSOrigin of replication, a centromere, and telomerase The chromosomal notation: 47, XX +18 represents which of the following human conditions? - ANSWERSA female with trisomy 18 (Edwards syndrome) Examine the original dsDNA gene segment along with the mutated dsDNA gene segment provided below. Determine what type of effect the mutation has at the 11rotein level. Original dsDNA gene segment 5' TTTATGTGTAGTTATTGATGC 3' 3' AAATACACATCAATAACTACG 5' (template strand) Mutated dsDNA gene segment 5' TTTATGTGAAGTTATTGATGC 3' 3' AAATACACirCAATAACTACG 5' (template strand) - ANSWERS.Nonsense mutation · Sickle Cell Disease (SCD) results from homozygous expression of abnormal beta globin genes caused by a single base substitution in which Adenine replaces Thymine. An variant form of hemoglobin (HbS) results from the new amino acid sequence. What type of mutation is this at the protein level? - ANSWERSMissense · The exchange of genetic information (genes) between two non-homologous chromosomes is referred to · as what type of chromosomal aberration? - ANSWERSReciprocal translocation


Document information

Uploaded on
June 11, 2024
Number of pages
4
Written in
2023/2024
Type
Exam (elaborations)
Contains
Questions & answers
$8.49

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
Bensuda
3.7
(165)
Sold
908
Followers
445
Items
23098
Last sold
2 days ago




Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions

Whoops! We can’t load your doc right now. Try again or contact support.