MLS EXAM 3 QUESTIONS & ANSWERS 2024/2025
MLS EXAM 3 QUESTIONS & ANSWERS 2024/2025 A functional human chromosome must include which of the following? - ANSWERSOrigin of replication, a centromere, and telomerase The chromosomal notation: 47, XX +18 represents which of the following human conditions? - ANSWERSA female with trisomy 18 (Edwards syndrome) Examine the original dsDNA gene segment along with the mutated dsDNA gene segment provided below. Determine what type of effect the mutation has at the 11rotein level. Original dsDNA gene segment 5' TTTATGTGTAGTTATTGATGC 3' 3' AAATACACATCAATAACTACG 5' (template strand) Mutated dsDNA gene segment 5' TTTATGTGAAGTTATTGATGC 3' 3' AAATACACirCAATAACTACG 5' (template strand) - ANSWERS.Nonsense mutation · Sickle Cell Disease (SCD) results from homozygous expression of abnormal beta globin genes caused by a single base substitution in which Adenine replaces Thymine. An variant form of hemoglobin (HbS) results from the new amino acid sequence. What type of mutation is this at the protein level? - ANSWERSMissense · The exchange of genetic information (genes) between two non-homologous chromosomes is referred to · as what type of chromosomal aberration? - ANSWERSReciprocal translocation
Document information
- Uploaded on
- June 11, 2024
- Number of pages
- 4
- Written in
- 2023/2024
- Type
- Exam (elaborations)
- Contains
- Questions & answers