CSE 180 Exam Questions and Answers With Verified Solutions 2025
What type of variable can have only one of two values - True or False? - ✔✔Boolean
What does the expression True and not (False or False) return? - ✔✔True
What does the expression True or ((not False) and False) return? - ✔✔True
Which built-in Python data structure consists of a set of key-value pairs? - ✔✔Dictionary
Let tea_party = ['March Hare', 'Hatter', 'Dormouse',
'Alice']
What is the value of tea_party[-1]? - ✔✔Alice
Compute PatternCount("AAA",
"GACCATCAAAACTGATAAACTACTTAAAAATCAGT"). - ✔✔6
What is the reverse complement of "GATTACA" ? - ✔✔TGTAATC
You are given the following Python code:
text="GATGCGGT"
for y in text[1:4]:
print(y)
What will be the output? - ✔✔ATG
You are given the following Python code:
x=0
for y in range(0,5):
, x += y
print(x)
What will be the output? - ✔✔10
What is the most frequent 3-mer of
"CGGAGGACTCTAGGTAACGCTTATCAGGTCCATAGGACATTCA" ? - ✔✔AGG
The position of the E. coli genome at which the skew attains a maximum
value is most likely near which of the following?
A. the origin of replication
B. the replication terminus
C. the middle of the forward strand
D. the middle of the reverse strand - ✔✔B
(extra credit) Identify the value of i for which the skew array of
"GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the
position of the first occurrence only, with 1-based numeration with respect
to the Genome (i.e., Skew[1] corresponds to "G" here) - ✔✔-2
What does chip-seq do? - ✔✔etermines protein-binding sites on DNA
Given 100-nucleotide long strings X = ATGC....CATA and Y = TATG....CTTG
with Count(X, ATAT) = 20 and Count(Y, ATAT) = 12, what is Count(X+Y,
ATAT)?
Note: X+Y denotes the concatenation of X and Y: ATGC....CATATATG....CTTG - ✔✔34
How many k-mers are there in a string of length n? - ✔✔n-k+1
extra credit) What will be the output of the following Python code?
What type of variable can have only one of two values - True or False? - ✔✔Boolean
What does the expression True and not (False or False) return? - ✔✔True
What does the expression True or ((not False) and False) return? - ✔✔True
Which built-in Python data structure consists of a set of key-value pairs? - ✔✔Dictionary
Let tea_party = ['March Hare', 'Hatter', 'Dormouse',
'Alice']
What is the value of tea_party[-1]? - ✔✔Alice
Compute PatternCount("AAA",
"GACCATCAAAACTGATAAACTACTTAAAAATCAGT"). - ✔✔6
What is the reverse complement of "GATTACA" ? - ✔✔TGTAATC
You are given the following Python code:
text="GATGCGGT"
for y in text[1:4]:
print(y)
What will be the output? - ✔✔ATG
You are given the following Python code:
x=0
for y in range(0,5):
, x += y
print(x)
What will be the output? - ✔✔10
What is the most frequent 3-mer of
"CGGAGGACTCTAGGTAACGCTTATCAGGTCCATAGGACATTCA" ? - ✔✔AGG
The position of the E. coli genome at which the skew attains a maximum
value is most likely near which of the following?
A. the origin of replication
B. the replication terminus
C. the middle of the forward strand
D. the middle of the reverse strand - ✔✔B
(extra credit) Identify the value of i for which the skew array of
"GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the
position of the first occurrence only, with 1-based numeration with respect
to the Genome (i.e., Skew[1] corresponds to "G" here) - ✔✔-2
What does chip-seq do? - ✔✔etermines protein-binding sites on DNA
Given 100-nucleotide long strings X = ATGC....CATA and Y = TATG....CTTG
with Count(X, ATAT) = 20 and Count(Y, ATAT) = 12, what is Count(X+Y,
ATAT)?
Note: X+Y denotes the concatenation of X and Y: ATGC....CATATATG....CTTG - ✔✔34
How many k-mers are there in a string of length n? - ✔✔n-k+1
extra credit) What will be the output of the following Python code?
