BISC 261 Exam Questions and answers with complete solutions Latest Updated 2025 |
Verified
Which of the following groups of eukaryotic microbes produce antibiotic compounds that we use to
treat bacterial infections?
A. Fungi
B. No eukaryotes naturally produce antibiotics
C. Protists
D. Algae - ✔️✔️Fungi
Which of the following would be the best method for reducing the transmission of endospore-forming
bacterial pathogens in health care settings?
A. Autoclaving all biomedical waste
B. Using 0.2-micrometer syringe filters when administering intravenous fluids
C. Using HEPA filtration
D. UV-C light irradiation of hospital rooms - ✔️✔️Autoclaving all biomedical waste
are constitutive genes. They are always expressed in cells. -
✔️✔️Housekeeping genes
Genes for catabolic pathways are usually genes. - ✔️✔️inducible
Genes for anabolic pathways are usually genes. - ✔️✔️repressible
The is an example of a catabolic pathway. - ✔️✔️lac operon
The is an example of a anabolic pathway. - ✔️✔️trp operon
, are any proteins with a , that bind
directly to the DNA double helix and cause changes in the transcription of genes. - ✔️✔️Transcriptional
regulatory proteins, helix-turn-helix motif
is when transcription is regulated by the binding of a repressor protein to
the operator region that results in the inhibition of transcription. - ✔️✔️Negative transcriptional control
is when transcription is regulated by the binding of an activator protein to
the activator binding sites that stimulates transcription. - ✔️✔️Positive transcriptional control
A is a protein that regulates the transcription of multiple different
operons from many different pathways in a cell. - ✔️✔️Global regulatory protein
is a common mechanism for global regulation in cells from all three
domains of life where binding of a molecule to a ,a membrane
protein, that initiates a single cascade through the cell via a ,a
membrane protein, which controls the transcription of many genes. Oftentimes the
signal is carried throughout cells via a . - ✔️✔️Two component signal
transduction; sensor kinase; integral; response regulators; peripheral; secondary messengers
Examples of secondary messengers include , which regulates pathways,
and , which regulates pathways that facilitates antibiotic resistance. - ✔️✔️cAMP; catabolite
repression; c-di-GMP
Consider the DNA sequence: TACCAACTACCAATAGTGACT. The sequence of the complementary DNA
strand in a double helix would be . - ✔️✔️ATGGTTGATGGTTATCACTGA
Which class of antibiotics inhibits bacterial cell wall biosynthesis?
A. Tetracyclines
B. Aminoglycosides
C. Penicillins
D. Sulfonamides - ✔️✔️Penicillins
Verified
Which of the following groups of eukaryotic microbes produce antibiotic compounds that we use to
treat bacterial infections?
A. Fungi
B. No eukaryotes naturally produce antibiotics
C. Protists
D. Algae - ✔️✔️Fungi
Which of the following would be the best method for reducing the transmission of endospore-forming
bacterial pathogens in health care settings?
A. Autoclaving all biomedical waste
B. Using 0.2-micrometer syringe filters when administering intravenous fluids
C. Using HEPA filtration
D. UV-C light irradiation of hospital rooms - ✔️✔️Autoclaving all biomedical waste
are constitutive genes. They are always expressed in cells. -
✔️✔️Housekeeping genes
Genes for catabolic pathways are usually genes. - ✔️✔️inducible
Genes for anabolic pathways are usually genes. - ✔️✔️repressible
The is an example of a catabolic pathway. - ✔️✔️lac operon
The is an example of a anabolic pathway. - ✔️✔️trp operon
, are any proteins with a , that bind
directly to the DNA double helix and cause changes in the transcription of genes. - ✔️✔️Transcriptional
regulatory proteins, helix-turn-helix motif
is when transcription is regulated by the binding of a repressor protein to
the operator region that results in the inhibition of transcription. - ✔️✔️Negative transcriptional control
is when transcription is regulated by the binding of an activator protein to
the activator binding sites that stimulates transcription. - ✔️✔️Positive transcriptional control
A is a protein that regulates the transcription of multiple different
operons from many different pathways in a cell. - ✔️✔️Global regulatory protein
is a common mechanism for global regulation in cells from all three
domains of life where binding of a molecule to a ,a membrane
protein, that initiates a single cascade through the cell via a ,a
membrane protein, which controls the transcription of many genes. Oftentimes the
signal is carried throughout cells via a . - ✔️✔️Two component signal
transduction; sensor kinase; integral; response regulators; peripheral; secondary messengers
Examples of secondary messengers include , which regulates pathways,
and , which regulates pathways that facilitates antibiotic resistance. - ✔️✔️cAMP; catabolite
repression; c-di-GMP
Consider the DNA sequence: TACCAACTACCAATAGTGACT. The sequence of the complementary DNA
strand in a double helix would be . - ✔️✔️ATGGTTGATGGTTATCACTGA
Which class of antibiotics inhibits bacterial cell wall biosynthesis?
A. Tetracyclines
B. Aminoglycosides
C. Penicillins
D. Sulfonamides - ✔️✔️Penicillins
