MB ASCP 2024 Exam Grade A 2024
MB ASCP 2024 Exam Grade A What genes would be screened in a lung cancer panel? - Answer ️️ -KRAS, EGFR, ALK In a retrovirus, the RNA acts as: - Answer ️️ -Genome and mRNA To what does the AcrAB gene product create resistance to? - Answer ️️ -Tetracycline What gene is measured following the treatment with imatinib(Gleevec)? - Answer ️️ - BCR/Abl Blood drawn into what type of tube is compatible for genetic testing? - Answer ️️ -K2-EDTA tube Primer dimers are due to what complimentary issue? - Answer ️️ -3' to 3' complementarity of primer pairs Microsatellite instability is best described as: - Answer ️️ -Contraction or expansion of the genomes caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs How many hydrogen bonds are formed between one C:G base pair? - Answer ️️ -3 When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them - Answer ️️ -Ligase What assay amplifies the target using DNA ligase? - Answer ️️ -LCR What genes would be screened in a breast cancer panel? - Answer ️️ -HER2, ERBB2, BRCA1 What factors can affect nucleic acid hybridization? - Answer ️️ -G:C ratio of bases pH of the hybridization reaction Hybridization temperature Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents combined have to pass down this affected gene to their child? - Answer ️️ -75% Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? - Answer ️️ -58*C The enzyme that primes DNA synthesis is: - Answer ️️ -DNA primase Splicing is the process that: - Answer ️️ -Removes introns and preserves exons All of the following enzymes are part of the DNA replication machinery - Answer ️️ -Ligase, DNA polymerase, Helicase This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - Answer ️️ -t(9;22) Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? - Answer ️️ -5'-ATCTATGTCGGCAATT-3' All of the following methods of amplification are considered target amplification: - Answer ️️ -Quantitative PCR Strand Displacement Amplification Reverse Transcriptase PCR What stain binds to minor groove of DNA Duplex? - Answer ️️ -SYBR1 The purines are: - Answer ️️ -Adenine and guanine Purines and pyrimidines differ from each other in that: - Answer ️️ -Purines have two rings; pyrimidines have one ring What gene is measured following treatment with Warfarin? - Answer ️️ -VKORC1 According to Chargaff's rule of base pairing, adenine pairs with: - Answer ️️ -Thymine When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately: - Answer ️️ -ΔCt = 3.3 The process of making RNA is termed: - Answer ️️ -Transcription When sequencing HLA-DR what is targeted? - Answer ️️ -Exon 2 of the β subunit All of the following are components of nucleic acids: - Answer ️️ -Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A,C,G,T) Branched DNA amplification (bDNA) is best classified as: - Answer ️️ -Signal amplification This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: - Answer ️️ -Molecular beacons What is the predominant form of DNA? - Answer ️️ -B form Mantle cell lymphoma (MCL) is caused by what translocation? - Answer ️️ -t(11;14) What responds poorly to Ribavarin/Interferon treatment? - Answer ️️ -HCV type 1 & 4 The sugar in DNA is: - Answer ️️ -Deoxyribose Why is it critical to maintain workflow from "clean" to "dirty" while working in a molecular lab? - Answer ️️ -To avoid contamination of specimens with amplified product which create false positive results Which two HPV types are responsible for most cases of cervical cancer? - Answer ️️ -16 and 18 The amelogenin locus, found on the sex chromosomes, is used in gender identification. Amplification at this locus reveals 2 peaks of sizes 212 and 218 base pairs. If this amplification were part of a gender identification procedure, what would be the gender of the individual? - Answer ️️ -Male This restriction enzyme "digests and removes a methyl group from Adenine": - Answer ️️ - Type I To what does the mecA gene product create resistance to? - Answer ️️ -Penicillin 3 cerebrospinal fluid (CSF) tubes labeled 1 through 3 have arrived in your clinical laboratory for evaluation. The tubes were numbered in the order in which they were obtained, with #1 being the first tube collected and #3 being the last tube collected. What is the best explanation for a macroscopic appearance seen in the CSF? - Answer ️️ -A traumatic tap Next Generation Sequencing set-up require: - Answer ️️ -Library preparation and extensive bioinformatics analysis The nitrogenous base in a nucleotide is expected to be found on which position of the sugar? - Answer ️️ -C1' In which of the following methods is the probe digested by the polymerase (Taq) during primer extension? - Answer ️️ -Taqman This polymerase is involved in "initiation of DNA replication and has primase activity": - Answer ️️ -Pol α What is the sequence recognized by poly (A) polymerase? - Answer ️️ -AAUAAA In the field of molecular diagnostics, which one of the following genes is responsible for the synthesis of DNA, promote cell division, and inhibit cell death? - Answer ️️ -Proto-oncogenes How is warfarin dosage affected in patients with VKORC1 deficiency? - Answer ️️ -Patients receive a lower warfarin dose This polymerase is involved in "short-patch base excision repair": - Answer ️️ -Pol β
Written for
- Institution
- ASCP MB
- Course
- ASCP MB
Document information
- Uploaded on
- February 21, 2024
- Number of pages
- 64
- Written in
- 2023/2024
- Type
- Exam (elaborations)
- Contains
- Questions & answers
Subjects
Also available in package deal