- Guías de estudio, Notas de estudios & Resúmenes

¿Buscas las mejores guías de estudio, notas de estudio y resúmenes para ? En esta página encontrarás 1 documentos de estudio para .

All 1 resultados

Ordenador por:

Examen

MB ASCP Demo Practice Exam Questions with 100% Correct Answers
-

-

-

2

agosto 2025

2025/2026

A+
1. Given the anti-sense strand of DNA: 5'- AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWER -A. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°
learndirect
$11.99 Más información