Written by students who passed Immediately available after payment Read online or as PDF Wrong document? Swap it for free 4.6 TrustPilot
logo-home
Document preview thumbnail
Preview 4 out of 270 pages
Exam (elaborations)

ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! S

Document preview thumbnail
Preview 4 out of 270 pages

ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! STUDY GUIDE EXAM ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! STUDY GUIDE EXAM ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! STUDY GUIDE EXAM ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! STUDY GUIDE EXAM ASCP Molecular Biology Certification Exam ,Most Recent Exam || 2025 /2026 Actual Complete Real Exam Questions With verified Answers (Correct Answers) Already Graded A+ , Guaranteed success| Newest Exam | Just Released !! STUDY GUIDE EXAM

Content preview

ASCP Molecular Biology Certification Exam ,Most Recent Exam
|| 2025 /2026 Actual Complete Real Exam Questions With
verified Answers (Correct Answers) Already Graded A+ ,
Guaranteed success| Newest Exam | Just Released !!
STUDY GUIDE EXAM




Histone acetylation close to the gene will increase or
decrease expression? -
ANSWER-
increase


siRNAs complementary to the gene transcript will
increase or decrease
expression? - ANSWER-
decrease


Calculate the DNA concentration from the
following:
260=0.172 (D.F. 1:100) - ANSWER-860 ug/mL = .172 abs * 50
ug/mL * 100 DF


[DNA] = 1535 ug/mL. You have 0.5 mL. What is the total yield.
- ANSWER-
767.5 ug = 1535 ug/mL *
0.5Ml

,[DNA] = 767.5 ug/mL. You have 0.5 mL What is the total yield.
- ANSWER-
383.75 ug = 767.5 ug/mL *
0.5 mL


[DNA] = 860 ug/mL. You have 0.5 mL. What is the total yield. -
ANSWER-430
ug = 860 ug/mL *
0.5mL


Calculate the RNA concentration from the following:
260=0.307 (DF 1:100) - ANSWER-1228 ug/mL = 0.307 abs * 40
ug/mL * 100
DF


An RNA preparation has the following readings:
260=0.208
280=0.096
Is this RNA suitable for use? - ANSWER-Yes, 2.17 is suitable for
RNA analysis
A260/A280 = 0.208/0.096


How does PFGE separate larger fragments more efficiently than
standard electrophoresis? - ANSWER-Repeated reorientation
forces larger fragments through the gel matrix more efficiently

,If fragments are dissolved in 50% formamide will the
stringency be higher or
lower? - ANSWER-
Higher


If fragments are dissolved in a high concentration of NaCl will
the stringency be
higher or lower? - ANSWER-
Lower


Does heating a solution from 65C to 75C during hybridization
raise or lower
stringency? - ANSWER-
raises


What would the autoradiogram show if the stringency was to
high? - ANSWER-
no
bands


Calculate the Tm of the following primers:
Forward: GGAGCTTTGTTTCAACCAAG
Reverse: ATTAAATGCGGAATTGCCCA - ANSWER-Forward:
Tm=(4C x
9GC)+(2C x 11AT) = 58C
Reverse Tm=(4C x 8GC)+(2C x 12AT) = 56C


Is 47;XXY a normal karyotype? - ANSWER-No, this is XXY
syndrome

, What is the genetic
abnormality of:
47,XY,+18 - ANSWER-Trisomy 18: Edwards
Syndrome


What is the genetic abnormality of:
46,XY,del(16p14) - ANSWER-Deletion in region 1, band 4 of the
short arm of chr 16


What is the genetic abnormality of:
iso(X)(q10) - ANSWER-Isochormosome comprised of the long
arms of the X chr


What is the genetic abnormality of:
46, XX, del(22q11.2) - ANSWER-Deletion in region 1, band 1,
sub-band 2 of the long arm of chr 22 (diGeorge's syndrome)


What is the genetic:
abnormality of
45, X - ANSWER-Monosomy X, Turner's
syndrome


How are nucleotides joined together? - ANSWER-condensation


What does mRNA do? - ANSWER-carries code out of cell.
code for protein
structure.

Document information

Uploaded on
December 3, 2025
Number of pages
270
Written in
2025/2026
Type
Exam (elaborations)
Contains
Questions & answers
$31.49

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
nyagajoseph539
3.8
(52)
Sold
231
Followers
14
Items
10124
Last sold
2 days ago


Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions