BIOL 4003 Exam 3 questions well
answered to pass
A mutation changes a valine codon to a histidine codon. This is a
a. silent mutation
b. missense mutation
c. frameshift mutation
d. nonsense mutation - correct answer ✔✔ b
A key event that promotes trinucleotide repeat expansion is
a. chromosome breakage
b. the formation of a hairpin
c. the presence of an AT-rich region
d. the presence of a lesion in the DNA - correct answer ✔✔ b
According to the Holliday model for homologous recombination, a heteroduplex is formed due
to
a. the initial breakage of the DNA at a single location in two different DNA strands
b. the formation of a D loop
c. the migration of a Holliday junction
d. the resolution of the Holliday junction into two separate DNA molecules - correct answer ✔✔
c
Following homologous recombination, gene conversion may occur via
a. mismatch DNA repair or nucleotide excision repair
,b. mismatch DNA repair or gap repair synthesis
c. nucleotide excision repair or non homologous end joining
d. nucleotide excision repair or gap repair synthesis - correct answer ✔✔ b
Which of the following proteins is/are needed during some types of retrotransposition, such as
they movements of Ty in yeast?
a. transposase
b. reverse transcriptase
c. integrase
d. b and c - correct answer ✔✔ d
Which of the following proteins is never needed during retrotransposition?
a. transposase
b. reverse transcriptase
c. integrase
d. all of the above may be needed - correct answer ✔✔ a
A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following
sequence: 5'GGATCCATGACTAGTCCGAC3'. A segment of DNA is cloned into a vector and then
the vector DNA is denatured and subjected to the dideoxy DNA sequencing method. Below is
the DNA sequence from a region in the vector. The primer annealing site is shown in bold and
underlined. 3'CCTAGGTACTGATCAGGCTG5'. What would be the sizes of the bands in the lane in
which dideoxyT had been added?
a. 1, 2, 5
b. 21, 22, 25
c. 3, 7
d. 23, 27 - correct answer ✔✔ b
, Why is taq polymerase used in PCR as opposed to DNA polymerase from another source such as
Ecoli?
a. synthesizes DNA faster
b. heat resistant
c. less likely to make errors
d. all of the above - correct answer ✔✔ b
Which of the following describes how Dolly was created?
a. a mammary cell was made totipotent by treating it with hormones
b. a mammary cell had its nucleus removed and the nucleus from a oocyte was inserted into it
c. a mammary cell was fused with an egg cell that had its nucleus removed
d. a sperm and egg cell were fused with a mammary cell that had its nucleus removed - correct
answer ✔✔ c
Glofish are zebrafish that contain a gene from either a coral or jellyfish. This is an example of
a. gene replacement
b. gene addition
c. gene editing
d. both a and b - correct answer ✔✔ b
A DNA microarray is used to
a. determine the sequence of a gene
b. examine gene expression at the level of the whole genome
c. clone genes into vectors following restriction digestion
d. determine if DNA replication has occured - correct answer ✔✔ b
Which of the following statements regarding a multiple sequence alignment is false?
answered to pass
A mutation changes a valine codon to a histidine codon. This is a
a. silent mutation
b. missense mutation
c. frameshift mutation
d. nonsense mutation - correct answer ✔✔ b
A key event that promotes trinucleotide repeat expansion is
a. chromosome breakage
b. the formation of a hairpin
c. the presence of an AT-rich region
d. the presence of a lesion in the DNA - correct answer ✔✔ b
According to the Holliday model for homologous recombination, a heteroduplex is formed due
to
a. the initial breakage of the DNA at a single location in two different DNA strands
b. the formation of a D loop
c. the migration of a Holliday junction
d. the resolution of the Holliday junction into two separate DNA molecules - correct answer ✔✔
c
Following homologous recombination, gene conversion may occur via
a. mismatch DNA repair or nucleotide excision repair
,b. mismatch DNA repair or gap repair synthesis
c. nucleotide excision repair or non homologous end joining
d. nucleotide excision repair or gap repair synthesis - correct answer ✔✔ b
Which of the following proteins is/are needed during some types of retrotransposition, such as
they movements of Ty in yeast?
a. transposase
b. reverse transcriptase
c. integrase
d. b and c - correct answer ✔✔ d
Which of the following proteins is never needed during retrotransposition?
a. transposase
b. reverse transcriptase
c. integrase
d. all of the above may be needed - correct answer ✔✔ a
A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following
sequence: 5'GGATCCATGACTAGTCCGAC3'. A segment of DNA is cloned into a vector and then
the vector DNA is denatured and subjected to the dideoxy DNA sequencing method. Below is
the DNA sequence from a region in the vector. The primer annealing site is shown in bold and
underlined. 3'CCTAGGTACTGATCAGGCTG5'. What would be the sizes of the bands in the lane in
which dideoxyT had been added?
a. 1, 2, 5
b. 21, 22, 25
c. 3, 7
d. 23, 27 - correct answer ✔✔ b
, Why is taq polymerase used in PCR as opposed to DNA polymerase from another source such as
Ecoli?
a. synthesizes DNA faster
b. heat resistant
c. less likely to make errors
d. all of the above - correct answer ✔✔ b
Which of the following describes how Dolly was created?
a. a mammary cell was made totipotent by treating it with hormones
b. a mammary cell had its nucleus removed and the nucleus from a oocyte was inserted into it
c. a mammary cell was fused with an egg cell that had its nucleus removed
d. a sperm and egg cell were fused with a mammary cell that had its nucleus removed - correct
answer ✔✔ c
Glofish are zebrafish that contain a gene from either a coral or jellyfish. This is an example of
a. gene replacement
b. gene addition
c. gene editing
d. both a and b - correct answer ✔✔ b
A DNA microarray is used to
a. determine the sequence of a gene
b. examine gene expression at the level of the whole genome
c. clone genes into vectors following restriction digestion
d. determine if DNA replication has occured - correct answer ✔✔ b
Which of the following statements regarding a multiple sequence alignment is false?
