Untitled-1 1 24/11/2018 2
, Focus on essential genetic topics and
explore the latest breakthroughs
Known for its focus on conceptual understanding, problem solving, and practical
applications, the bestselling Essentials of Genetics strengthens problem-solving
skills and explores the essential genetics topics that today’s students need
to understand. The 10th Edition has been extensively updated to provide
comprehensive coverage of important, emerging topics such as CRISPR-Cas,
epigenetics, and genetic testing. Mastering Genetics includes new tutorials
on topics such as CRISPR-Cas and epigenetics, and new, mobile-ready Dynamic
Study Modules, which prepare students for class and support the learning of
key concepts.
Spencer | Palladino | Killian
Klug | Cummings
genetics. Chromosomes are
to be observed in living cells.
recognizable human chromo-
pear only once in the lifetime
rch, there are still mysteries
n chromosomes. We discuss
Sequence Organization.
and practical applications, the
lls and explores the essential
Edition has been extensively
g topics such as CRISPR-Cas,
cs chapter covers Advances
ESSENTIALS of GENETICS
says on Genetics, Ethics, and
into everyday life.
Tenth Edition
ESSENTIALS
ent, in mind, offering:
r feedback
ncludes embedded videos
of GENETICS
ore—all accessible on any
ne.
ild your confidence on
a time, indicating your
ons, you’re given feedback
smartphones, tablets,
Klug | Cummings | Spencer | Palladino | Killian
r lengthy discussion for every
s, including extra study prob-
ow to study genetics.
www.pearson.com for more information.
our products, contact our customer service
00) 824-7799, or (201) 767-5021 outside of
your campus bookstore.
www.pearson.com
Tenth
Edition
A01_KLUG8414_10_SE_FM.indd 1 16/11/18 5:08
, Make genetics relevant . . .
NEW! Regulation
16
of gene expression
has been expanded
and is now divided into
coverage of bacteria
Regulation of in Chapter 15 and
Gene Expression in coverage of eukaryotes
Eukaryotes in Chapter 16.
CHAPTER CONCEPTS
■■ While transcription and translation are
tightly coupled in bacteria, in eukary-
otes, these processes are spatially and
temporally separated, and thus inde-
Chromosome territories in a human fibroblast cell nucleus. Each
pendently regulated. chromosome is stained with a different-colored probe.
■■ Chromatin remodeling, as well as
modifications to DNA and histones,
play important roles in regulating gene
expression in eukaryotes.
V
■■ Eukaryotic transcription initiation irtually all cells in a multicellular eukaryotic organism contain a
requires the assembly of transcrip- complete genome; however, such organisms often possess differ-
tion regulatory proteins on DNA sites ent cell types with diverse morphologies and functions. This simple
known as promoters, enhancers, and observation highlights the importance of the regulation of gene expression
silencers. in eukaryotes. For example, skin cells and muscle cells differ in appearance
■■ Following transcription, there are sev- and function because they express different genes. Skin cells express kera-
eral mechanisms that regulate gene tins, fibrous structural proteins that bestow the skin with protective prop-
expression, referred to as posttranscrip- erties. Muscle cells express high levels of myosin II, a protein that mediates
tional regulation. muscle contraction. Skin cells do not express myosin II, and muscle cells do
■■ Alternative splicing allows for a single not express keratins.
gene to encode different protein iso- In addition to gene expression that is cell-type specific, some genes are
forms with different functions. only expressed under certain conditions or at certain times. For example,
■■ RNA-binding proteins regulate mRNA when oxygen levels in the blood are low, such as at high altitude or after
stability, degradation, localization, and rigorous exercise, expression of the hormone erythropoietin is upregulated,
translation. which leads to an increase in red blood cell production and thus oxygen-
■■ Noncoding RNAs may regulate gene carrying capacity.
expression by targeting mRNAs for Underscoring the importance of regulation, the misregulation of genes
destruction or translational inhibition.
P. 302
in eukaryotes is associated with developmental defects and disease. For
■■ Posttranslational modification of pro- instance, the overexpression of genes that regulate cellular growth can
their degradation.
298
teins can alter their activity or promote lead15to uncontrolled
RegulAtioN cellularof
proliferation, a hallmark of cancer.
geNe expRessioN Therefore,
iN BActeRiA
understanding the mechanisms that control gene expression in eukaryotes
is of great interest and may lead to therapies for human diseases.
Coverage of Streptococcus thermophilus CRISPR locus
CRISPR-Cas302 Repeats
is expanded GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
and Leader
integrated
M16_KLUG8414_10_SE_C16.indd 302 14/09/2018 13:58
in multiple
chapters – Spacer 1 Spacer 3
GAGCTACCAGCTACCCCGTATGTCAGAGAG TAGATTTAATCAGTAATGAGTTAGGCATAA
Chapters 1, 15, (Streptococcus phage 20617) (Streptococcus phage TP-778L)
17, and Special Spacer 2
TTGAATACCAATGCCAGCTTCTTTTAAGGC
Topics Chapters (Streptococcus phage CHPC1151)
ST3 and ST6.
FIGURE 15.13 A cRispR locus from the bacterium Streptococcus thermophilus (lMg18311).
spacer sequences are derived from portions of bacteriophage genomes and are flanked on
either side by a repeat sequence. only 3 of 33 total spacers in this cRispR locus are shown.
P. 298
description of repeated DNA sequences with nonrepetitive genes encode a wide variety of Cas proteins such as DNases,
spacer sequences between them. Since then, CRISPR loci RNases, and proteins of unknown function. The CRISPR-Cas
have been identified in ∙ 50 percent of bacteria species mechanism includes three steps outlined in Figure 15.14.
and in ∙ 90 percent of archaea, another type of prokaryote
1. The first step is known as spacer acquisition. Invading
(Figure 15.13). The spacers remained a mystery until 2005
phage DNA is cleaved into small fragments, which are
when three independent studies demonstrated that CRISPR
directly inserted into the CRISPR locus to become new
spacer sequences were identical to fragments of phage
spacers. The Cas1 nuclease and an associated Cas2 pro-
genomes. This insight led to speculation that viral sequences
tein are required for spacer acquisition. New spacers are
within CRISPR loci serve as a “molecular memory” of previ-
inserted proximal to the leader sequence of the CRISPR
ous viral attacks.
locus, with older spacers being located progressively more
A01_KLUG8414_10_SE_FM.indd 2 The first experimental evidence that CRISPRs are impor- 16/11/18 5:08
distal. When new spacers are added, repeat sequences are
tant for adaptive immunity came from an unexpected place.
duplicated such that each spacer is flanked by repeats.
Danisco, a Danish food science company, sought to create a
, with current high interest topics
SP EC I A L TOPIC S IN MOD ERN G ENE T IC S 2 NEW! Special
Topics chapter on
Genetic Testing
Genetic Testing guides students
through the many
contexts in which
genetic testing is
E
arlier in the text (see Chapters 17 and 18), we dystrophy. Other tests have been developed for disorders that
reviewed essential concepts of recombinant DNA may involve multiple genes such as certain types of cancers. becoming prominent
technology and genomic analysis. Because of the Gene tests are used for prenatal, childhood, and adult
Human Genome Project and related advances in genomics, prognosis and diagnosis of genetic diseases; to identify car- and explores many
researchers have been making rapid progress in identifying riers; and to identify genetic diseases in embryos created by questions and ethical
genes involved in both single-gene diseases and complex in vitro fertilization, among other applications. For genetic
genetic traits. As a result, genetic testing—the ability to testing of adults, DNA from white blood cells is commonly concerns related to its
analyze DNA, and increasingly RNA, for
the purposes of identifying specific genes or
used. Alternatively, many genetic tests can
be carried out on cheek cells, collected by
use.
sequences associated with different genetic “Genetic testing, swabbing the inside of the mouth, or on hair
conditions—has advanced very rapidly. including genomic cells. Some genetic testing can be carried out
Genetic testing, including genomic analysis by DNA on gametes.
analysis by DNA sequencing, is transform- What does it mean when a genetic test
ing medical diagnostics. Technologies for
sequencing, is trans- is performed for prognostic purposes, and
forming medical
SPECIAL TOPIC X
genetic testing have had major impacts how does this differ from a diagnostic test? A
on the diagnosis of disease and are revolu- diagnostics. Technolo- prognostic test predicts a person’s likelihood
tionizing medical treatments based on the gies for genetic test- of developing a particular genetic disorder. P. 450
development of specific and effective phar-
ing have had major A diagnostic test for a genetic condition
maceuticals. In this Special Topics chapter identifies a particular mutation or genetic
impacts on the diagno- change that causes the disease or condition.
we provide an overview of applications SP EC I A L TOPIC S IN MOD ERN G ENE T IC S 4
that are effective for the genetic testing of sis of disease and are Sometimes a diagnostic test identifies a gene
children and adults and examine histori- revolutionizing medical or mutation associated with a condition,
cal and modern methods. We consider the
impact of different genetic technologies on
Advances in Neurogenetics: The Study
treatments based on but the test will not be able to determine
whether the gene or mutation is the cause
the development of of the disorder or is a genetic variation that
the diagnosis of human diseases and dis-
ease treatment. Finally, we consider some specific and effective of Huntington Disease
results from the condition.
of the social, ethical, and legal implications pharmaceuticals.”
of genetic testing.
NEW! Special
A
ST s2.2 Prenatal
the result Genetic
of groundbreaking Testing
advances in molec- know about the molecular and cellular mechanisms associ-
Topics chapter
ST 2.1 Testing for Prognostic
ular genetics and genomics made since the 1970s,
to Screen for Conditions
new fields in genetics and related disciplines have
ated with the disorder, particularly those discovered during
the study of transgenic model systems. Finally, we will con-
on Advances
or Diagnostic Purposes in emerged. One new field is neurogenetics—the study of the sider how this information is being used to develop a range
Although genetic testing of adults is increasing, over the past
Neurogenetics: genetic basis of normal and abnormal functioning of the ner-
two decades more genetic testing has been used to detect
vous system, with emphasis on brain functions. Research in
of therapies.
Genetic testing was one of the first successful applications of genetic conditions in babies than in adults. In newborns, a
Therecombinant
StudyDNAof technology, and currently more than 900
this field includes the genes associated with neurodegenera-
simple prick of a baby’s heel produces a few drops of blood
tive disorders, with the ultimate goal of developing effective
Huntington
tests are in use that Disease,
target a specific gene or sequence. Increas-
ingly, scientists and physicians can directly examine an indi-
that are used to check the newborn for many genetic dis-
orders. In the United States, all states now require geneticST 4.1 The Search for the Huntington
therapies to combat these devastating conditions. Of the
explores how
vidual’s DNA genetic
for mutations associated with disease, including
many such diseases, including Alzheimer disease, Parkin-
testing, often called newborn screening, for certain medicalGene
son disease, and amyotrophic lateral sclerosis (ALS), Hun-
analysis has informed
through DNA sequencing, as we will discuss in Section ST 2.5.
These tests usually detect gene alterations associated with
conditions (the number of diseases screened for is set by
tington disease (HD) stands out as a model for the genetic
the individual state, see Box 1). There are currently aboutMapping the gene for Huntington disease was one of the
investigation of neurodegenerative disorders. Not only is it
scientists
single-geneabout
disorders. the 60 conditions
But, only about 3900 genes have been monogenic and 100that can bepenetrant,
percent detected, although
but nearlymany of thesefirst attempts to employ a method from a landmark 1980
all ana-
tests
linked to such disorders. Examples include sickle-cell anemia, lytical detect proteins or other metabolites and are not DNA-paper by Botstein, White, and Davis in which the authors
disease’s causes,
SPECIAL TOPIC 4
approaches in molecular genetics have been success-
cystic fibrosis, Huntington disease, hemophilia, and muscular fully orapplied
RNA-based genetic proposed that DNA sequence variations in humans could be
to the study tests.
of HD, validating
symptoms, and future its significance as a model for these diseases.
detected as differences in the length of DNA
450
“Driving with my fragments produced by cutting DNA with
treatment. All Special HD is an autosomal dominant disorder
characterized by adult onset of defined and father through a restriction enzymes. These differences,
Topics chapters include progressive behavioral changes, including wooded road leading
known as restriction fragment length
polymorphisms (RFLPs), could be visual-
uncontrolled movements (chorea), cogni-
a series of questions
M02A_KLUG8414_10_SE_ST02.indd 450 tive decline, and psychiatric disturbances,
from Easthampton ized using Southern blots (see Chapter 18
10/13/18 2:41 AM
to Amagansett, we for a discussion of RFLPs, and Chapter 17
that help students with death occurring within 10 to 15 years
for a discussion of Southern blots). The
after symptoms appear. HD was one of the suddenly came upon
review key ideas or first examples of complete dominance in two women, mother
authors estimated that a collection of about
150 RFLPs distributed across the genome
facilitate personal human inheritance, with no differences in
phenotypes between homozygotes and het-
and daughter, both could be used with pedigrees to detect link-
contemplations and erozygotes. In the vast majority of cases,
bowing, twisting, age anywhere in the genome between an
symptoms do not develop until about age 45. grimacing. I stared in
RFLP marker and a disease gene of interest.
group discussions, Overall, HD currently affects about 25,000 wonderment, almost
In practical terms, this meant that it would
be possible to map a disease gene with no
and are assignable in to 30,000 people in North America. in fear. What could it information about the gene, its gene prod-
The disease is named after George
Mastering Genetics. Huntington, a nineteenth-century physician.
mean?” uct, or its function—an approach referred
to as reverse genetics.
He was not the first to describe the disorder,
but his account was so comprehensive and detailed (see Box 1) P. 482
that the disease eventually took on his name. Further, his Finding Linkage between Huntington Disease
observation of transgenerational cases in several families and an RFLP Marker
precisely matched an autosomal dominant pattern of inheri- In the early 1980s, Huntington disease research was largely
tance. Shortly after the rediscovery of Mendel’s work in the driven by the Hereditary Disease Foundation, established
early twentieth century, pedigree analysis confirmed that by the family of Leonore Wexler, who, along with her three
HD is inherited as an autosomal dominant disorder. brothers, died of Huntington disease. One daughter, Nancy,
We will begin our consideration of Huntington disease after learning about the proposal to map disease genes using
by discussing the successful efforts to map, isolate, and clone DNA markers, used her awareness of a large population
the HD gene. We will then turn our attention to what we affected with Huntington disease in Venezuela to organize
1
A01_KLUG8414_10_SE_FM.indd 3 16/11/18 5:08
, Focus on essential genetic topics and
explore the latest breakthroughs
Known for its focus on conceptual understanding, problem solving, and practical
applications, the bestselling Essentials of Genetics strengthens problem-solving
skills and explores the essential genetics topics that today’s students need
to understand. The 10th Edition has been extensively updated to provide
comprehensive coverage of important, emerging topics such as CRISPR-Cas,
epigenetics, and genetic testing. Mastering Genetics includes new tutorials
on topics such as CRISPR-Cas and epigenetics, and new, mobile-ready Dynamic
Study Modules, which prepare students for class and support the learning of
key concepts.
Spencer | Palladino | Killian
Klug | Cummings
genetics. Chromosomes are
to be observed in living cells.
recognizable human chromo-
pear only once in the lifetime
rch, there are still mysteries
n chromosomes. We discuss
Sequence Organization.
and practical applications, the
lls and explores the essential
Edition has been extensively
g topics such as CRISPR-Cas,
cs chapter covers Advances
ESSENTIALS of GENETICS
says on Genetics, Ethics, and
into everyday life.
Tenth Edition
ESSENTIALS
ent, in mind, offering:
r feedback
ncludes embedded videos
of GENETICS
ore—all accessible on any
ne.
ild your confidence on
a time, indicating your
ons, you’re given feedback
smartphones, tablets,
Klug | Cummings | Spencer | Palladino | Killian
r lengthy discussion for every
s, including extra study prob-
ow to study genetics.
www.pearson.com for more information.
our products, contact our customer service
00) 824-7799, or (201) 767-5021 outside of
your campus bookstore.
www.pearson.com
Tenth
Edition
A01_KLUG8414_10_SE_FM.indd 1 16/11/18 5:08
, Make genetics relevant . . .
NEW! Regulation
16
of gene expression
has been expanded
and is now divided into
coverage of bacteria
Regulation of in Chapter 15 and
Gene Expression in coverage of eukaryotes
Eukaryotes in Chapter 16.
CHAPTER CONCEPTS
■■ While transcription and translation are
tightly coupled in bacteria, in eukary-
otes, these processes are spatially and
temporally separated, and thus inde-
Chromosome territories in a human fibroblast cell nucleus. Each
pendently regulated. chromosome is stained with a different-colored probe.
■■ Chromatin remodeling, as well as
modifications to DNA and histones,
play important roles in regulating gene
expression in eukaryotes.
V
■■ Eukaryotic transcription initiation irtually all cells in a multicellular eukaryotic organism contain a
requires the assembly of transcrip- complete genome; however, such organisms often possess differ-
tion regulatory proteins on DNA sites ent cell types with diverse morphologies and functions. This simple
known as promoters, enhancers, and observation highlights the importance of the regulation of gene expression
silencers. in eukaryotes. For example, skin cells and muscle cells differ in appearance
■■ Following transcription, there are sev- and function because they express different genes. Skin cells express kera-
eral mechanisms that regulate gene tins, fibrous structural proteins that bestow the skin with protective prop-
expression, referred to as posttranscrip- erties. Muscle cells express high levels of myosin II, a protein that mediates
tional regulation. muscle contraction. Skin cells do not express myosin II, and muscle cells do
■■ Alternative splicing allows for a single not express keratins.
gene to encode different protein iso- In addition to gene expression that is cell-type specific, some genes are
forms with different functions. only expressed under certain conditions or at certain times. For example,
■■ RNA-binding proteins regulate mRNA when oxygen levels in the blood are low, such as at high altitude or after
stability, degradation, localization, and rigorous exercise, expression of the hormone erythropoietin is upregulated,
translation. which leads to an increase in red blood cell production and thus oxygen-
■■ Noncoding RNAs may regulate gene carrying capacity.
expression by targeting mRNAs for Underscoring the importance of regulation, the misregulation of genes
destruction or translational inhibition.
P. 302
in eukaryotes is associated with developmental defects and disease. For
■■ Posttranslational modification of pro- instance, the overexpression of genes that regulate cellular growth can
their degradation.
298
teins can alter their activity or promote lead15to uncontrolled
RegulAtioN cellularof
proliferation, a hallmark of cancer.
geNe expRessioN Therefore,
iN BActeRiA
understanding the mechanisms that control gene expression in eukaryotes
is of great interest and may lead to therapies for human diseases.
Coverage of Streptococcus thermophilus CRISPR locus
CRISPR-Cas302 Repeats
is expanded GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
and Leader
integrated
M16_KLUG8414_10_SE_C16.indd 302 14/09/2018 13:58
in multiple
chapters – Spacer 1 Spacer 3
GAGCTACCAGCTACCCCGTATGTCAGAGAG TAGATTTAATCAGTAATGAGTTAGGCATAA
Chapters 1, 15, (Streptococcus phage 20617) (Streptococcus phage TP-778L)
17, and Special Spacer 2
TTGAATACCAATGCCAGCTTCTTTTAAGGC
Topics Chapters (Streptococcus phage CHPC1151)
ST3 and ST6.
FIGURE 15.13 A cRispR locus from the bacterium Streptococcus thermophilus (lMg18311).
spacer sequences are derived from portions of bacteriophage genomes and are flanked on
either side by a repeat sequence. only 3 of 33 total spacers in this cRispR locus are shown.
P. 298
description of repeated DNA sequences with nonrepetitive genes encode a wide variety of Cas proteins such as DNases,
spacer sequences between them. Since then, CRISPR loci RNases, and proteins of unknown function. The CRISPR-Cas
have been identified in ∙ 50 percent of bacteria species mechanism includes three steps outlined in Figure 15.14.
and in ∙ 90 percent of archaea, another type of prokaryote
1. The first step is known as spacer acquisition. Invading
(Figure 15.13). The spacers remained a mystery until 2005
phage DNA is cleaved into small fragments, which are
when three independent studies demonstrated that CRISPR
directly inserted into the CRISPR locus to become new
spacer sequences were identical to fragments of phage
spacers. The Cas1 nuclease and an associated Cas2 pro-
genomes. This insight led to speculation that viral sequences
tein are required for spacer acquisition. New spacers are
within CRISPR loci serve as a “molecular memory” of previ-
inserted proximal to the leader sequence of the CRISPR
ous viral attacks.
locus, with older spacers being located progressively more
A01_KLUG8414_10_SE_FM.indd 2 The first experimental evidence that CRISPRs are impor- 16/11/18 5:08
distal. When new spacers are added, repeat sequences are
tant for adaptive immunity came from an unexpected place.
duplicated such that each spacer is flanked by repeats.
Danisco, a Danish food science company, sought to create a
, with current high interest topics
SP EC I A L TOPIC S IN MOD ERN G ENE T IC S 2 NEW! Special
Topics chapter on
Genetic Testing
Genetic Testing guides students
through the many
contexts in which
genetic testing is
E
arlier in the text (see Chapters 17 and 18), we dystrophy. Other tests have been developed for disorders that
reviewed essential concepts of recombinant DNA may involve multiple genes such as certain types of cancers. becoming prominent
technology and genomic analysis. Because of the Gene tests are used for prenatal, childhood, and adult
Human Genome Project and related advances in genomics, prognosis and diagnosis of genetic diseases; to identify car- and explores many
researchers have been making rapid progress in identifying riers; and to identify genetic diseases in embryos created by questions and ethical
genes involved in both single-gene diseases and complex in vitro fertilization, among other applications. For genetic
genetic traits. As a result, genetic testing—the ability to testing of adults, DNA from white blood cells is commonly concerns related to its
analyze DNA, and increasingly RNA, for
the purposes of identifying specific genes or
used. Alternatively, many genetic tests can
be carried out on cheek cells, collected by
use.
sequences associated with different genetic “Genetic testing, swabbing the inside of the mouth, or on hair
conditions—has advanced very rapidly. including genomic cells. Some genetic testing can be carried out
Genetic testing, including genomic analysis by DNA on gametes.
analysis by DNA sequencing, is transform- What does it mean when a genetic test
ing medical diagnostics. Technologies for
sequencing, is trans- is performed for prognostic purposes, and
forming medical
SPECIAL TOPIC X
genetic testing have had major impacts how does this differ from a diagnostic test? A
on the diagnosis of disease and are revolu- diagnostics. Technolo- prognostic test predicts a person’s likelihood
tionizing medical treatments based on the gies for genetic test- of developing a particular genetic disorder. P. 450
development of specific and effective phar-
ing have had major A diagnostic test for a genetic condition
maceuticals. In this Special Topics chapter identifies a particular mutation or genetic
impacts on the diagno- change that causes the disease or condition.
we provide an overview of applications SP EC I A L TOPIC S IN MOD ERN G ENE T IC S 4
that are effective for the genetic testing of sis of disease and are Sometimes a diagnostic test identifies a gene
children and adults and examine histori- revolutionizing medical or mutation associated with a condition,
cal and modern methods. We consider the
impact of different genetic technologies on
Advances in Neurogenetics: The Study
treatments based on but the test will not be able to determine
whether the gene or mutation is the cause
the development of of the disorder or is a genetic variation that
the diagnosis of human diseases and dis-
ease treatment. Finally, we consider some specific and effective of Huntington Disease
results from the condition.
of the social, ethical, and legal implications pharmaceuticals.”
of genetic testing.
NEW! Special
A
ST s2.2 Prenatal
the result Genetic
of groundbreaking Testing
advances in molec- know about the molecular and cellular mechanisms associ-
Topics chapter
ST 2.1 Testing for Prognostic
ular genetics and genomics made since the 1970s,
to Screen for Conditions
new fields in genetics and related disciplines have
ated with the disorder, particularly those discovered during
the study of transgenic model systems. Finally, we will con-
on Advances
or Diagnostic Purposes in emerged. One new field is neurogenetics—the study of the sider how this information is being used to develop a range
Although genetic testing of adults is increasing, over the past
Neurogenetics: genetic basis of normal and abnormal functioning of the ner-
two decades more genetic testing has been used to detect
vous system, with emphasis on brain functions. Research in
of therapies.
Genetic testing was one of the first successful applications of genetic conditions in babies than in adults. In newborns, a
Therecombinant
StudyDNAof technology, and currently more than 900
this field includes the genes associated with neurodegenera-
simple prick of a baby’s heel produces a few drops of blood
tive disorders, with the ultimate goal of developing effective
Huntington
tests are in use that Disease,
target a specific gene or sequence. Increas-
ingly, scientists and physicians can directly examine an indi-
that are used to check the newborn for many genetic dis-
orders. In the United States, all states now require geneticST 4.1 The Search for the Huntington
therapies to combat these devastating conditions. Of the
explores how
vidual’s DNA genetic
for mutations associated with disease, including
many such diseases, including Alzheimer disease, Parkin-
testing, often called newborn screening, for certain medicalGene
son disease, and amyotrophic lateral sclerosis (ALS), Hun-
analysis has informed
through DNA sequencing, as we will discuss in Section ST 2.5.
These tests usually detect gene alterations associated with
conditions (the number of diseases screened for is set by
tington disease (HD) stands out as a model for the genetic
the individual state, see Box 1). There are currently aboutMapping the gene for Huntington disease was one of the
investigation of neurodegenerative disorders. Not only is it
scientists
single-geneabout
disorders. the 60 conditions
But, only about 3900 genes have been monogenic and 100that can bepenetrant,
percent detected, although
but nearlymany of thesefirst attempts to employ a method from a landmark 1980
all ana-
tests
linked to such disorders. Examples include sickle-cell anemia, lytical detect proteins or other metabolites and are not DNA-paper by Botstein, White, and Davis in which the authors
disease’s causes,
SPECIAL TOPIC 4
approaches in molecular genetics have been success-
cystic fibrosis, Huntington disease, hemophilia, and muscular fully orapplied
RNA-based genetic proposed that DNA sequence variations in humans could be
to the study tests.
of HD, validating
symptoms, and future its significance as a model for these diseases.
detected as differences in the length of DNA
450
“Driving with my fragments produced by cutting DNA with
treatment. All Special HD is an autosomal dominant disorder
characterized by adult onset of defined and father through a restriction enzymes. These differences,
Topics chapters include progressive behavioral changes, including wooded road leading
known as restriction fragment length
polymorphisms (RFLPs), could be visual-
uncontrolled movements (chorea), cogni-
a series of questions
M02A_KLUG8414_10_SE_ST02.indd 450 tive decline, and psychiatric disturbances,
from Easthampton ized using Southern blots (see Chapter 18
10/13/18 2:41 AM
to Amagansett, we for a discussion of RFLPs, and Chapter 17
that help students with death occurring within 10 to 15 years
for a discussion of Southern blots). The
after symptoms appear. HD was one of the suddenly came upon
review key ideas or first examples of complete dominance in two women, mother
authors estimated that a collection of about
150 RFLPs distributed across the genome
facilitate personal human inheritance, with no differences in
phenotypes between homozygotes and het-
and daughter, both could be used with pedigrees to detect link-
contemplations and erozygotes. In the vast majority of cases,
bowing, twisting, age anywhere in the genome between an
symptoms do not develop until about age 45. grimacing. I stared in
RFLP marker and a disease gene of interest.
group discussions, Overall, HD currently affects about 25,000 wonderment, almost
In practical terms, this meant that it would
be possible to map a disease gene with no
and are assignable in to 30,000 people in North America. in fear. What could it information about the gene, its gene prod-
The disease is named after George
Mastering Genetics. Huntington, a nineteenth-century physician.
mean?” uct, or its function—an approach referred
to as reverse genetics.
He was not the first to describe the disorder,
but his account was so comprehensive and detailed (see Box 1) P. 482
that the disease eventually took on his name. Further, his Finding Linkage between Huntington Disease
observation of transgenerational cases in several families and an RFLP Marker
precisely matched an autosomal dominant pattern of inheri- In the early 1980s, Huntington disease research was largely
tance. Shortly after the rediscovery of Mendel’s work in the driven by the Hereditary Disease Foundation, established
early twentieth century, pedigree analysis confirmed that by the family of Leonore Wexler, who, along with her three
HD is inherited as an autosomal dominant disorder. brothers, died of Huntington disease. One daughter, Nancy,
We will begin our consideration of Huntington disease after learning about the proposal to map disease genes using
by discussing the successful efforts to map, isolate, and clone DNA markers, used her awareness of a large population
the HD gene. We will then turn our attention to what we affected with Huntington disease in Venezuela to organize
1
A01_KLUG8414_10_SE_FM.indd 3 16/11/18 5:08
