BIOL 111 Past Exam Questions With Complete Solutions
A biologist is studying a cell that has enzymes, linear
chromosomes (linear genome), a plasma membrane, ribosomes,
and mitochondria. Given only this information, this cell COULD
BE
a. a plant cell or an animal cell but not a bacterial cell.
b. a bacterial cell or a plant cell.
c. a bacterial cell but not a plant cell.
d. a plant cell but neither a bacterial cell nor an animal cell.
e. an animal cell or a bacterial cell but not a plant cell. Correct
Answers a. a plant cell or an animal cell but not a bacterial cell.
A particular viral genome can replicate in 8 hours. If you start
with 55,000 copies of this genome, about how many copies
would be present in a host's cell after 48 hours of growth?
a. ~110,000
b. ~330,000
c. ~1,760,000
d. ~3,520,000
e. Correct amount not listed Correct Answers d. ~3,520,000
A scientist finds a new protein in a rare tropical fruit. Which of
the following is the BEST prediction about the properties of this
protein?
a. It will certainly have no more than 20 different types of
monomers in its structure.
b. It will certainly be coded for by a sequence of DNA that is
equal in length to the protein.
c. It will likely have new monomers that have never been found
in nature before.
,d. It most likely functions as an energy storage molecule.
e. It will be less than or equal to twenty monomers long.
Correct Answers a. It will certainly have no more than 20
different types of monomers in its structure.
A unicellular eukaryote undergoes multiple rounds of glycolysis
and yields 48 molecules of pyruvate. How many total molecules
of ATP will the investment payoff phase yield? (Yield does
NOT mean net).
a. 96
b. 48
c. 24
d. 192
e. 0 Correct Answers a. 96
A valid scientific hypothesis must be:
a. Funded (monetarily supported)
b. Testable and Falsifiable
c. Testable and Provable
d. Provable
e. Unable to be changed (permanent) Correct Answers b.
Testable and Falsifiable
Acetylation of histones in the area of a gene causes that gene to
a. turn off or down in expression levels.
b. mutate and cause a change in gene functionality.
c. alternatively splice during transcript processing.
d. turn on or up in expression levels.
e. amend damaged pieces via excision repair. Correct Answers
d. turn on or up in expression levels.
,Alfred Wallace is best known for what?
a. The theory of endosymbiosis leading to the evoluton of the
mitochondria & cholorplast.
b. Being the "father of taxonomy" and coming up with a system
of organization.
c. Suggesting natural selection as a mechanism for evolution.
d. The first person to describe a cell and credited with the cell
theory.
e. Proposing the idea of the inheritance of acquired traits.
Correct Answers c. Suggesting natural selection as a
mechanism for evolution.
At a specific area on a chromosome, the sequence of nucleotides
below is present where the DNA opens to form a replication
fork for RNA synthesis via transcription:
3' C C T A G G C T G C A A T C C 5'
5' G G A T C C G A C G T T A G G 3'
An RNA primer is formed starting at the bolded base pair of the
template. Which of the following represents the primer
sequence?
a. 5' T C G G A T C C 3'
b. 5' G C C T A G G 3'
c. 5' A C G T T A G G 3'
d. 5' A C G U U A G G 3'
e. 5' G C C U A G G 3' Correct Answers d. 5' A C G U U A G
G 3'
Below is a fully processed mRNA transcript. What will be the
amino acid sequence produced by translation of this message?
(ur gonna need a codon table)
, 5'
GCACGCAACAUGAUCUUCGUUAUCCUGGUAUGAACG
UAUAAAAAAAAAAA 3'
a. met-ile-phe-val-ile-leu-val
b. ala-arg-asn-met-ile-phe-val-ile-leu-val
c. met-met-leu-val-ser-leu-ser
d. ala-arg-asn-ile-phe-val-ile-leu-val
e. met-ile-phe-val-ile-leu-val-try-stop-lys Correct Answers a.
met-ile-phe-val-ile-leu-val
BO3H3
Boric acid, shown above, can be used in a number of medical
applications. Very dilute solutions can treat both bacterial and
fungal infections. How many grams of boric acid would be
required to make 4 L of a 0.5 M solution? (Atomic mass of
boron = 11, oxygen = 16, hydrogen = 1)
a. 124g
b. 12.4g
c. 6.2g
d. 62g
e. 248g Correct Answers a. 124g
COOH
Which type of functional group is depicted above (entire picture,
not just one part), and which type of molecule would you find it
in?
a. amino group, amino acids
b. hydroxyl group, carbohydrates
c. methyl group, proteins
A biologist is studying a cell that has enzymes, linear
chromosomes (linear genome), a plasma membrane, ribosomes,
and mitochondria. Given only this information, this cell COULD
BE
a. a plant cell or an animal cell but not a bacterial cell.
b. a bacterial cell or a plant cell.
c. a bacterial cell but not a plant cell.
d. a plant cell but neither a bacterial cell nor an animal cell.
e. an animal cell or a bacterial cell but not a plant cell. Correct
Answers a. a plant cell or an animal cell but not a bacterial cell.
A particular viral genome can replicate in 8 hours. If you start
with 55,000 copies of this genome, about how many copies
would be present in a host's cell after 48 hours of growth?
a. ~110,000
b. ~330,000
c. ~1,760,000
d. ~3,520,000
e. Correct amount not listed Correct Answers d. ~3,520,000
A scientist finds a new protein in a rare tropical fruit. Which of
the following is the BEST prediction about the properties of this
protein?
a. It will certainly have no more than 20 different types of
monomers in its structure.
b. It will certainly be coded for by a sequence of DNA that is
equal in length to the protein.
c. It will likely have new monomers that have never been found
in nature before.
,d. It most likely functions as an energy storage molecule.
e. It will be less than or equal to twenty monomers long.
Correct Answers a. It will certainly have no more than 20
different types of monomers in its structure.
A unicellular eukaryote undergoes multiple rounds of glycolysis
and yields 48 molecules of pyruvate. How many total molecules
of ATP will the investment payoff phase yield? (Yield does
NOT mean net).
a. 96
b. 48
c. 24
d. 192
e. 0 Correct Answers a. 96
A valid scientific hypothesis must be:
a. Funded (monetarily supported)
b. Testable and Falsifiable
c. Testable and Provable
d. Provable
e. Unable to be changed (permanent) Correct Answers b.
Testable and Falsifiable
Acetylation of histones in the area of a gene causes that gene to
a. turn off or down in expression levels.
b. mutate and cause a change in gene functionality.
c. alternatively splice during transcript processing.
d. turn on or up in expression levels.
e. amend damaged pieces via excision repair. Correct Answers
d. turn on or up in expression levels.
,Alfred Wallace is best known for what?
a. The theory of endosymbiosis leading to the evoluton of the
mitochondria & cholorplast.
b. Being the "father of taxonomy" and coming up with a system
of organization.
c. Suggesting natural selection as a mechanism for evolution.
d. The first person to describe a cell and credited with the cell
theory.
e. Proposing the idea of the inheritance of acquired traits.
Correct Answers c. Suggesting natural selection as a
mechanism for evolution.
At a specific area on a chromosome, the sequence of nucleotides
below is present where the DNA opens to form a replication
fork for RNA synthesis via transcription:
3' C C T A G G C T G C A A T C C 5'
5' G G A T C C G A C G T T A G G 3'
An RNA primer is formed starting at the bolded base pair of the
template. Which of the following represents the primer
sequence?
a. 5' T C G G A T C C 3'
b. 5' G C C T A G G 3'
c. 5' A C G T T A G G 3'
d. 5' A C G U U A G G 3'
e. 5' G C C U A G G 3' Correct Answers d. 5' A C G U U A G
G 3'
Below is a fully processed mRNA transcript. What will be the
amino acid sequence produced by translation of this message?
(ur gonna need a codon table)
, 5'
GCACGCAACAUGAUCUUCGUUAUCCUGGUAUGAACG
UAUAAAAAAAAAAA 3'
a. met-ile-phe-val-ile-leu-val
b. ala-arg-asn-met-ile-phe-val-ile-leu-val
c. met-met-leu-val-ser-leu-ser
d. ala-arg-asn-ile-phe-val-ile-leu-val
e. met-ile-phe-val-ile-leu-val-try-stop-lys Correct Answers a.
met-ile-phe-val-ile-leu-val
BO3H3
Boric acid, shown above, can be used in a number of medical
applications. Very dilute solutions can treat both bacterial and
fungal infections. How many grams of boric acid would be
required to make 4 L of a 0.5 M solution? (Atomic mass of
boron = 11, oxygen = 16, hydrogen = 1)
a. 124g
b. 12.4g
c. 6.2g
d. 62g
e. 248g Correct Answers a. 124g
COOH
Which type of functional group is depicted above (entire picture,
not just one part), and which type of molecule would you find it
in?
a. amino group, amino acids
b. hydroxyl group, carbohydrates
c. methyl group, proteins
