BIOL 4003 Exam 3
A mutation changes a valine codon to a histidine codon. This is a
a. silent mutation
b. missense mutation
c. frameshift mutation
d. nonsense mutation - answers-b
A key event that promotes trinucleotide repeat expansion is
a. chromosome breakage
b. the formation of a hairpin
c. the presence of an AT-rich region
d. the presence of a lesion in the DNA - answers-b
According to the Holliday model for homologous recombination, a heteroduplex is formed due to
a. the initial breakage of the DNA at a single location in two different DNA strands
b. the formation of a D loop
c. the migration of a Holliday junction
d. the resolution of the Holliday junction into two separate DNA molecules - answers-c
Following homologous recombination, gene conversion may occur via
a. mismatch DNA repair or nucleotide excision repair
b. mismatch DNA repair or gap repair synthesis
c. nucleotide excision repair or non-homologous end joining
d. nucleotide excision repair or gap repair synthesis - answers-b
, Which of the following proteins is/are needed during some types of retro transposition, such as they
movements of Ty in yeast?
a. transposase
b. reverse transcriptase
c. integrase
d. b and c - answers-d
Which of the following proteins is never needed during retro transposition?
a. transposase
b. reverse transcriptase
c. integrase
d. all of the above may be needed - answers-a
A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following sequence:
5'GGATCCATGACTAGTCCGAC3'. A segment of DNA is cloned into a vector and then the vector DNA is
denatured and subjected to the dideoxy DNA sequencing method. Below is the DNA sequence from a
region in the vector. The primer annealing site is shown in bold and underlined.
3'CCTAGGTACTGATCAGGCTG5'. What would be the sizes of the bands in the lane in which dideoxy had
been added?
a. 1, 2, 5
b. 21, 22, 25
c. 3, 7
d. 23, 27 - answers-b
Why is tax polymerase used in PCR as opposed to DNA polymerase from another source such as E. coli?
a. synthesizes DNA faster
b. heat resistant
c. less likely to make errors
d. all of the above - answers-b
A mutation changes a valine codon to a histidine codon. This is a
a. silent mutation
b. missense mutation
c. frameshift mutation
d. nonsense mutation - answers-b
A key event that promotes trinucleotide repeat expansion is
a. chromosome breakage
b. the formation of a hairpin
c. the presence of an AT-rich region
d. the presence of a lesion in the DNA - answers-b
According to the Holliday model for homologous recombination, a heteroduplex is formed due to
a. the initial breakage of the DNA at a single location in two different DNA strands
b. the formation of a D loop
c. the migration of a Holliday junction
d. the resolution of the Holliday junction into two separate DNA molecules - answers-c
Following homologous recombination, gene conversion may occur via
a. mismatch DNA repair or nucleotide excision repair
b. mismatch DNA repair or gap repair synthesis
c. nucleotide excision repair or non-homologous end joining
d. nucleotide excision repair or gap repair synthesis - answers-b
, Which of the following proteins is/are needed during some types of retro transposition, such as they
movements of Ty in yeast?
a. transposase
b. reverse transcriptase
c. integrase
d. b and c - answers-d
Which of the following proteins is never needed during retro transposition?
a. transposase
b. reverse transcriptase
c. integrase
d. all of the above may be needed - answers-a
A primer used in dideoxy DNA sequencing is 20 nucleotides long and has the following sequence:
5'GGATCCATGACTAGTCCGAC3'. A segment of DNA is cloned into a vector and then the vector DNA is
denatured and subjected to the dideoxy DNA sequencing method. Below is the DNA sequence from a
region in the vector. The primer annealing site is shown in bold and underlined.
3'CCTAGGTACTGATCAGGCTG5'. What would be the sizes of the bands in the lane in which dideoxy had
been added?
a. 1, 2, 5
b. 21, 22, 25
c. 3, 7
d. 23, 27 - answers-b
Why is tax polymerase used in PCR as opposed to DNA polymerase from another source such as E. coli?
a. synthesizes DNA faster
b. heat resistant
c. less likely to make errors
d. all of the above - answers-b
