MB ASCP QUESTIONS
& ANSWERS WITH COMPLETE
SOLUTIONS GRADED A+
QUESTIONS AND ANSWERS
What genes would be screened in a lung cancer panel?. ANSWER -KRAS, EGFR,
ALK
In a retrovirus, the RNA acts as:. ANSWER -Genome and mRNA
To what does the AcrAB gene product create resistance to?. ANSWER -Tetracycline
What gene is measured following the treatment with imatinib(Gleevec)?. ANSWER -
BCR/Abl
Blood drawn into what type of tube is compatible for genetic testing?. ANSWER -K2-
EDTA tube
Primer dimers are due to what complimentary issue?. ANSWER -3' to 3'
complementarity of primer pairs
Microsatellite instability is best described as:. ANSWER -Contraction or expansion of
the genomes caused by frameshift mutations (deletions or insertions) in elements of
the genome consisting of a repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base pair?. ANSWER -3
,When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it
closes them. ANSWER -Ligase
What assay amplifies the target using DNA ligase?. ANSWER -LCR
What genes would be screened in a breast cancer panel?. ANSWER -HER2, ERBB2,
BRCA1
What factors can affect nucleic acid hybridization?. ANSWER -G:C ratio of bases
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What percent chance do
these parents combined have to pass down this affected gene to their child?.
ANSWER -75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a
hybridization procedure. What is the melting temperature, Tm, of the sequence?.
ANSWER -58*C
The enzyme that primes DNA synthesis is:. ANSWER -DNA primase
Splicing is the process that:. ANSWER -Removes introns and preserves exons
,All of the following enzymes are part of the DNA replication machinery. ANSWER -
Ligase, DNA polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene on one chromosome
and the BCR gene on the other chromosome, resulting in chronic myelogenous
leukemia (CML):. ANSWER -t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the
appropriate sense strand?. ANSWER -5'-ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target amplification:.
ANSWER -Quantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex?. ANSWER -SYBR1
The purines are:. ANSWER -Adenine and guanine
Purines and pyrimidines differ from each other in that:. ANSWER -Purines have two
rings; pyrimidines have one ring
What gene is measured following treatment with Warfarin?. ANSWER -VKORC1
, According to Chargaff's rule of base pairing, adenine pairs with:. ANSWER -Thymine
When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen
as approximately:. ANSWER -ΔCt = 3.3
The process of making RNA is termed:. ANSWER -Transcription
When sequencing HLA-DR what is targeted?. ANSWER -Exon 2 of the β subunit
All of the following are components of nucleic acids:. ANSWER -Phosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as:. ANSWER -Signal
amplification
This PCR method works by generating a signal at the annealing step (i.e. when the
probe binds its target) of the PCR reaction:. ANSWER -Molecular beacons
What is the predominant form of DNA?. ANSWER -B form
Mantle cell lymphoma (MCL) is caused by what translocation?. ANSWER -t(11;14)
& ANSWERS WITH COMPLETE
SOLUTIONS GRADED A+
QUESTIONS AND ANSWERS
What genes would be screened in a lung cancer panel?. ANSWER -KRAS, EGFR,
ALK
In a retrovirus, the RNA acts as:. ANSWER -Genome and mRNA
To what does the AcrAB gene product create resistance to?. ANSWER -Tetracycline
What gene is measured following the treatment with imatinib(Gleevec)?. ANSWER -
BCR/Abl
Blood drawn into what type of tube is compatible for genetic testing?. ANSWER -K2-
EDTA tube
Primer dimers are due to what complimentary issue?. ANSWER -3' to 3'
complementarity of primer pairs
Microsatellite instability is best described as:. ANSWER -Contraction or expansion of
the genomes caused by frameshift mutations (deletions or insertions) in elements of
the genome consisting of a repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base pair?. ANSWER -3
,When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it
closes them. ANSWER -Ligase
What assay amplifies the target using DNA ligase?. ANSWER -LCR
What genes would be screened in a breast cancer panel?. ANSWER -HER2, ERBB2,
BRCA1
What factors can affect nucleic acid hybridization?. ANSWER -G:C ratio of bases
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What percent chance do
these parents combined have to pass down this affected gene to their child?.
ANSWER -75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a
hybridization procedure. What is the melting temperature, Tm, of the sequence?.
ANSWER -58*C
The enzyme that primes DNA synthesis is:. ANSWER -DNA primase
Splicing is the process that:. ANSWER -Removes introns and preserves exons
,All of the following enzymes are part of the DNA replication machinery. ANSWER -
Ligase, DNA polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene on one chromosome
and the BCR gene on the other chromosome, resulting in chronic myelogenous
leukemia (CML):. ANSWER -t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the
appropriate sense strand?. ANSWER -5'-ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target amplification:.
ANSWER -Quantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex?. ANSWER -SYBR1
The purines are:. ANSWER -Adenine and guanine
Purines and pyrimidines differ from each other in that:. ANSWER -Purines have two
rings; pyrimidines have one ring
What gene is measured following treatment with Warfarin?. ANSWER -VKORC1
, According to Chargaff's rule of base pairing, adenine pairs with:. ANSWER -Thymine
When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen
as approximately:. ANSWER -ΔCt = 3.3
The process of making RNA is termed:. ANSWER -Transcription
When sequencing HLA-DR what is targeted?. ANSWER -Exon 2 of the β subunit
All of the following are components of nucleic acids:. ANSWER -Phosphate group
Sugar (ribose or deoxyribose)
Nitrogenous base (A,C,G,T)
Branched DNA amplification (bDNA) is best classified as:. ANSWER -Signal
amplification
This PCR method works by generating a signal at the annealing step (i.e. when the
probe binds its target) of the PCR reaction:. ANSWER -Molecular beacons
What is the predominant form of DNA?. ANSWER -B form
Mantle cell lymphoma (MCL) is caused by what translocation?. ANSWER -t(11;14)
