BSC 219 – Final Questions AND Correct Answers
A ___________________________ is a set of DNA variations, or polymorphisms, that tend to be
inherited together.
a. linkage
b. haplotype
c. segment
d. transposable element - ✔✔b
A Sanger sequencing gel is shown. What do the black rectangles represent?
a. DNA molecules
b. RNA molecules
c. Primers
d. Telomeres - ✔✔a
According to the diagram, what is the sequence of the non-template strand?
a. 3' ATGCGTTTGCGCC 5'
b. 3' TACGCAAACGCGG 5'
c. 5' TACGCAAACGCGG 3'
d. 5' ATGCGTTTGCGCC 3' - ✔✔d
According to the diagram, what is the sequence of the template strand?
a. 3' ATGCGTTTGCGCC 5'
b. 3' TACGCAAACGCGG 5'
c. 5' TACGCAAACGCGG 3'
d. 5' ATGCGTTTGCGCC 3' - ✔✔b
Agrobacterium tumefaciens induces tumor formation in its host. Which is the most widely held
assumption with respect to A. tumefaciens-induced tumor formation?
a. Tumor formation causes death of the host.
,b. Tumors attract oxygenated blood.
c. Tumor cells produce a difficult to catabolize molecule.
d. Tumor cells attract herbivores that can transport A. tumefaciens to new hosts. - ✔✔c
Agrobacterium tumefaciens is a ___________________________.
a. fungal organism
b. bacterium that cannot carry plasmids
c. human carcinogen
d. genome engineer
e. a thermophilic snail species - ✔✔d
Animal studies suggest that recombinant AAV genomes typically
______________________________________________.
a. persist as single DNA molecules in the nuclei of non-dividing cells.
b. persist as single circular DNA molecules in the nuclei of non-dividing cells.
c. persist as concatemerized linear DNA molecules in the nuclei of non-dividing cells.
d. persist as concatemerized circular DNA molecules in the nuclei of non-dividing cells. - ✔✔d
Approximate the melting temperature of the following oligonucleotide by hand (use the method
described in the notes/videos): 5' GCGCGATATAGCGCGAAATT 3'
a. 50 °C
b. 58 °C
c. 60 °C
d. 64 °C
e. 70 °C - ✔✔c
Approximately how many recombinant viral particles were delivered intravenously to the patients of the
gene therapy trial in Video 2?
a. 5-50 million viral particles per kg of patient's weight
b. 50-200 million viral particles per kg of patient's weight
, c. 5-50 billion viral particles per kg of patient's weight
d. 50-200 trillion viral particles per kg of patient's weight - ✔✔d
Approximately how much of the human genome consists of transposable elements? Are most of the
transposable elements in the human genome functional?
a. 1%; most are functional
b. 25%; most are functional
c. 50%; most are functional
d. 1%; most are NOT functional
e. 25%; most are NOT functional
f. 50%; most are NOT functional - ✔✔f
Approximately what percentage of the human genome is made of L1 elements and Aluelements?
a. 5% L1; 0.5% Alu
b. 5% L1; 5% Alu
c. 20% L1; 0.5% Alu
d. 20% L1; 10% Alu
e. 5% L1; 10% Alu
f. 0.5% L1; 0.5% Alu - ✔✔d
Assume the Manhattan plot below was generated from a GWAS study on human height.
Which of the below most likely represents the points of the plot.
a. height of participants in the study
b. general weight associated sequences of each participant
c. single nucleotide polymorphisms in the human genome
d. age of the participants in the study - ✔✔c
A ___________________________ is a set of DNA variations, or polymorphisms, that tend to be
inherited together.
a. linkage
b. haplotype
c. segment
d. transposable element - ✔✔b
A Sanger sequencing gel is shown. What do the black rectangles represent?
a. DNA molecules
b. RNA molecules
c. Primers
d. Telomeres - ✔✔a
According to the diagram, what is the sequence of the non-template strand?
a. 3' ATGCGTTTGCGCC 5'
b. 3' TACGCAAACGCGG 5'
c. 5' TACGCAAACGCGG 3'
d. 5' ATGCGTTTGCGCC 3' - ✔✔d
According to the diagram, what is the sequence of the template strand?
a. 3' ATGCGTTTGCGCC 5'
b. 3' TACGCAAACGCGG 5'
c. 5' TACGCAAACGCGG 3'
d. 5' ATGCGTTTGCGCC 3' - ✔✔b
Agrobacterium tumefaciens induces tumor formation in its host. Which is the most widely held
assumption with respect to A. tumefaciens-induced tumor formation?
a. Tumor formation causes death of the host.
,b. Tumors attract oxygenated blood.
c. Tumor cells produce a difficult to catabolize molecule.
d. Tumor cells attract herbivores that can transport A. tumefaciens to new hosts. - ✔✔c
Agrobacterium tumefaciens is a ___________________________.
a. fungal organism
b. bacterium that cannot carry plasmids
c. human carcinogen
d. genome engineer
e. a thermophilic snail species - ✔✔d
Animal studies suggest that recombinant AAV genomes typically
______________________________________________.
a. persist as single DNA molecules in the nuclei of non-dividing cells.
b. persist as single circular DNA molecules in the nuclei of non-dividing cells.
c. persist as concatemerized linear DNA molecules in the nuclei of non-dividing cells.
d. persist as concatemerized circular DNA molecules in the nuclei of non-dividing cells. - ✔✔d
Approximate the melting temperature of the following oligonucleotide by hand (use the method
described in the notes/videos): 5' GCGCGATATAGCGCGAAATT 3'
a. 50 °C
b. 58 °C
c. 60 °C
d. 64 °C
e. 70 °C - ✔✔c
Approximately how many recombinant viral particles were delivered intravenously to the patients of the
gene therapy trial in Video 2?
a. 5-50 million viral particles per kg of patient's weight
b. 50-200 million viral particles per kg of patient's weight
, c. 5-50 billion viral particles per kg of patient's weight
d. 50-200 trillion viral particles per kg of patient's weight - ✔✔d
Approximately how much of the human genome consists of transposable elements? Are most of the
transposable elements in the human genome functional?
a. 1%; most are functional
b. 25%; most are functional
c. 50%; most are functional
d. 1%; most are NOT functional
e. 25%; most are NOT functional
f. 50%; most are NOT functional - ✔✔f
Approximately what percentage of the human genome is made of L1 elements and Aluelements?
a. 5% L1; 0.5% Alu
b. 5% L1; 5% Alu
c. 20% L1; 0.5% Alu
d. 20% L1; 10% Alu
e. 5% L1; 10% Alu
f. 0.5% L1; 0.5% Alu - ✔✔d
Assume the Manhattan plot below was generated from a GWAS study on human height.
Which of the below most likely represents the points of the plot.
a. height of participants in the study
b. general weight associated sequences of each participant
c. single nucleotide polymorphisms in the human genome
d. age of the participants in the study - ✔✔c
