08/23/2023
Emergent property:
- Characteristic an entity gains when it becomes part of a bigger system
- Molecules, organelles, cells, tissues, organs, organisms, population, communities, ecosystems, biosphere
- Different components/properties found within an object/ thing
Valence Electrons
- Amount of electrons within the outer shell of an atom
- Electrons are organized in layers (shells)
- Electrons shells carry electrons which are attracted to the protons in the nucleus
What is the significance of the number of unpaired valence electrons? :
- They are reactive (unstable)
Atomic number:
- Number of protons within the element
- Number of protons and electrons are the same
Bonds:
- Covalent bond: Sharing electrons
- Ionic bond: Attraction between an anion and cation (not sharing electrons/ non-covalent bond)
- Polar covalent bond: One atom is more electronegative
Ions:
- Positive ion = Cation
- Negative ion = Anion
Electronegativity (EN):
- The amount of attraction an element has to electrons of a covalent bond
- Electron transfer: Formation of ions that are attracted to each other
- Huge difference in EN between atoms: Polar covalent bond
- Little difference in EN between atoms:
- No difference in EN between atoms: Non-polar covalent bond
Hydrogen bonding:
- Attracts two water molecules together
- Weak attraction
- Partial negative + partial positive
- Hydrogen
BOXED Q
Biological Hierarchy + Compounds:
- How do the interactions of elements of different levels - (more complex/ less complex) ? (Q)
- Smaller parts combine to make increasingly complex systems (example, Molecules combine to create
organelles, organelles combine to make cells, etc.) (A)
- A: When the pH goes up, the solution becomes more alkaline (meaning there is less hydrogen)
- B: When the pH goes down, the solution becomes more acidic (meaning there is more hydrogen)
08/28/2023
Cohesion: Substance attracted to itself
Adhesion: Substance attracted to another substance
Surface tension:
Emergent properties of water:
- Ability to moderate temperature
- High specific heat which allows it to have evaporative cooling (sweating) (meaning it can absorb lots of
energy before the temperature of the water goes up)
- Universal solvent
, - Many substances can be dissolved in water (water-soluble)
- Ability to freeze:
- The space between molecules is greater in solid form (ice) than in liquid or gas form (expands)
- Temperature buffer
- Cohesive behavior
- Allows for water to act as a column (can go upwards/ downwards)
Kinetic Energy: Energy of motion
Heat: Measure of the total amount of kinetic energy due to molecular motion (molecules are always in movement)
Temperature: Measures the intensity of the heat due to the average kinetic energy of molecules (regardless of
volume)
4 major classes of life’s organic macromolecules:
- Carbohydrates (mono, di, oligo, and polysaccharides)
- Proteins
- Nucleic acids
- Lipids
Dehydration reaction:
- Removes a water molecule, forming a new bond, synthesizing a polymer
Hydrolysis:
- Adding a water molecule to break apart a bond/ polymer
08/30/2023
Carbohydrates:
- Specific kinds of carbohydrates:
- Glucose, fructose, lactose, cellulose, maltose, sucrose, galactose
- Chitin (polysaccharide):
- Structurally similar to cellulose
- Monosaccharides:
- Simple sugars
- Formulas of CH2O
- C = O (carbonyl group)
- How do monosaccharides differ from one another?
- # of carbons,
- Joined by dehydration reaction to make disaccharides and polysaccharides
Lipids:
- Types:
- Fats, steroids, phospholipids
- Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
- Glycerol:
- Water soluble (hydrophilic)
- Ester linkage:
- Bonds glycerol to fatty acids (3x = triglyceride)
- 2 ways fats differ:
- Chain link (structure)
- Types of bonds
- Saturated fatty acid:
, - No bending
- Room temperature
- Unsaturated fatty acid:
- Bending
- Liquid (at a lower temperature)
- Heat = Energy = Movement
Discussion SGQ:
ATGCCGTCTGACACATGCCCGTAA
TACGGCAGACTGTGTACGGGCATT
AUGCCGUCUGACACAUGCCCGUAA
09/01/2023
Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
Phospholipids:
- Part polar
- 2 fatty acid chains attached to a glycerol
- Hydrophilic head
- Hydrophobic tail
- Creates a bi-layer when submerged in water:
Steroids:
- Cholesterol:
- Regulates fluidity on animal cell membranes
- 4 rings
Amino acid:
- Amino group:
- NH2 (amino)
- Acid
, - COOH (carboxyl)
Peptide bond:
- Covalent bond between C atom
Protein structure:
- Secondary:
- Alpha-helix and Beta-pleated sheets
09/06/2023 - Protein structures/ levels
- Proteins are polymers made of monomers
- Primary structure: sequence of amino acids covalently bonded with one another
- Alpha helix, beta pleated sheets
- Tertiary structure: bonds between different R groups within a protein help keep it in shape
Denaturation of a protein:
- Heat
- pH
What is the relationship between nucleic acid, a nucleotide, and a dna?
09/08/2023: Origins of Life on Earth
- Evolution:
- Reproduction, Variation, Genetic mutations, etc.
Three domains of life:
- Organisms are divided into 3 main domains:
- Archaea
- Bacteria
- Eukarya:
- Three multicellular kingdoms:
- Plants
- Fungi
- Animals
First single celled organism:
- Stromatolites (fossils formed by the accumulation of prokaryotes)
Emergent property:
- Characteristic an entity gains when it becomes part of a bigger system
- Molecules, organelles, cells, tissues, organs, organisms, population, communities, ecosystems, biosphere
- Different components/properties found within an object/ thing
Valence Electrons
- Amount of electrons within the outer shell of an atom
- Electrons are organized in layers (shells)
- Electrons shells carry electrons which are attracted to the protons in the nucleus
What is the significance of the number of unpaired valence electrons? :
- They are reactive (unstable)
Atomic number:
- Number of protons within the element
- Number of protons and electrons are the same
Bonds:
- Covalent bond: Sharing electrons
- Ionic bond: Attraction between an anion and cation (not sharing electrons/ non-covalent bond)
- Polar covalent bond: One atom is more electronegative
Ions:
- Positive ion = Cation
- Negative ion = Anion
Electronegativity (EN):
- The amount of attraction an element has to electrons of a covalent bond
- Electron transfer: Formation of ions that are attracted to each other
- Huge difference in EN between atoms: Polar covalent bond
- Little difference in EN between atoms:
- No difference in EN between atoms: Non-polar covalent bond
Hydrogen bonding:
- Attracts two water molecules together
- Weak attraction
- Partial negative + partial positive
- Hydrogen
BOXED Q
Biological Hierarchy + Compounds:
- How do the interactions of elements of different levels - (more complex/ less complex) ? (Q)
- Smaller parts combine to make increasingly complex systems (example, Molecules combine to create
organelles, organelles combine to make cells, etc.) (A)
- A: When the pH goes up, the solution becomes more alkaline (meaning there is less hydrogen)
- B: When the pH goes down, the solution becomes more acidic (meaning there is more hydrogen)
08/28/2023
Cohesion: Substance attracted to itself
Adhesion: Substance attracted to another substance
Surface tension:
Emergent properties of water:
- Ability to moderate temperature
- High specific heat which allows it to have evaporative cooling (sweating) (meaning it can absorb lots of
energy before the temperature of the water goes up)
- Universal solvent
, - Many substances can be dissolved in water (water-soluble)
- Ability to freeze:
- The space between molecules is greater in solid form (ice) than in liquid or gas form (expands)
- Temperature buffer
- Cohesive behavior
- Allows for water to act as a column (can go upwards/ downwards)
Kinetic Energy: Energy of motion
Heat: Measure of the total amount of kinetic energy due to molecular motion (molecules are always in movement)
Temperature: Measures the intensity of the heat due to the average kinetic energy of molecules (regardless of
volume)
4 major classes of life’s organic macromolecules:
- Carbohydrates (mono, di, oligo, and polysaccharides)
- Proteins
- Nucleic acids
- Lipids
Dehydration reaction:
- Removes a water molecule, forming a new bond, synthesizing a polymer
Hydrolysis:
- Adding a water molecule to break apart a bond/ polymer
08/30/2023
Carbohydrates:
- Specific kinds of carbohydrates:
- Glucose, fructose, lactose, cellulose, maltose, sucrose, galactose
- Chitin (polysaccharide):
- Structurally similar to cellulose
- Monosaccharides:
- Simple sugars
- Formulas of CH2O
- C = O (carbonyl group)
- How do monosaccharides differ from one another?
- # of carbons,
- Joined by dehydration reaction to make disaccharides and polysaccharides
Lipids:
- Types:
- Fats, steroids, phospholipids
- Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
- Glycerol:
- Water soluble (hydrophilic)
- Ester linkage:
- Bonds glycerol to fatty acids (3x = triglyceride)
- 2 ways fats differ:
- Chain link (structure)
- Types of bonds
- Saturated fatty acid:
, - No bending
- Room temperature
- Unsaturated fatty acid:
- Bending
- Liquid (at a lower temperature)
- Heat = Energy = Movement
Discussion SGQ:
ATGCCGTCTGACACATGCCCGTAA
TACGGCAGACTGTGTACGGGCATT
AUGCCGUCUGACACAUGCCCGUAA
09/01/2023
Fats:
- Glycerol + 3 fatty acids
- Stores energy
- Must be liquid to be functional
Phospholipids:
- Part polar
- 2 fatty acid chains attached to a glycerol
- Hydrophilic head
- Hydrophobic tail
- Creates a bi-layer when submerged in water:
Steroids:
- Cholesterol:
- Regulates fluidity on animal cell membranes
- 4 rings
Amino acid:
- Amino group:
- NH2 (amino)
- Acid
, - COOH (carboxyl)
Peptide bond:
- Covalent bond between C atom
Protein structure:
- Secondary:
- Alpha-helix and Beta-pleated sheets
09/06/2023 - Protein structures/ levels
- Proteins are polymers made of monomers
- Primary structure: sequence of amino acids covalently bonded with one another
- Alpha helix, beta pleated sheets
- Tertiary structure: bonds between different R groups within a protein help keep it in shape
Denaturation of a protein:
- Heat
- pH
What is the relationship between nucleic acid, a nucleotide, and a dna?
09/08/2023: Origins of Life on Earth
- Evolution:
- Reproduction, Variation, Genetic mutations, etc.
Three domains of life:
- Organisms are divided into 3 main domains:
- Archaea
- Bacteria
- Eukarya:
- Three multicellular kingdoms:
- Plants
- Fungi
- Animals
First single celled organism:
- Stromatolites (fossils formed by the accumulation of prokaryotes)