Written by students who passed Immediately available after payment Read online or as PDF Wrong document? Swap it for free 4.6 TrustPilot
logo-home
Exam (elaborations)

AMCB 2023 Test Questions with Correct Answers

Rating
-
Sold
-
Pages
5
Grade
A+
Uploaded on
19-03-2024
Written in
2023/2024

Rated A+ best nursing exam 100%pass

Institution
AMCB 2023
Course
AMCB 2023

Content preview

AMCB 2023 Test Questions with Correct Answers To verify DNA purity we have to: - Answer -Measure absorbance at 260 nm and 280 nm. The addition of proteinase K in the buffer ATL is to: - Answer -Disrupt the cell envelope to lyse cells. The genomic DNA that we extract from cells (of any kind) is polar and sticky. This property is useful for purification purposes. Which of the following surfaces is likely to be used, with good efficiency, to purify DNA. - Answer -A glass rod/bar To quantify DNA we should: - Answer -Measure absorbance at 260 nm. In this course the use of a chimera or chimerical molecule is applied to: - Answer -
Genetic recombinant molecules. Select the group describing the type of DNA vectors mentioned in the course: - Answer -
Shuttle vectors - Expression plasmids - Reporter plasmids - Suicide plasmids Extraction protocol: Once the bacterial cells are lysed and the cell free extracts are loaded into the column, the plasmids will: - Answer -Be retained on the filter made of glass fibers. The gene SacB encodes for: - Answer -A) The enzyme levan sucrase. B) A toxic enzyme when expressed in E. coli. Select the best definition of a PLASMID: - Answer -A circular genetic structure that replicates independently of the chromosome The use of plasmids is extremely flexible, including the use of viral genes to be inserted and expressed in different kinds of cells. - Answer -True A general characteristic of the plasmids used in biotechnology is a gene conferring antibiotic resistance - Answer -True The bla gene in p15TV -L used in this lab encodes for: - Answer -B) B-lactamase. C) Resistance to ampicillin. In the p15TV -L vector, the SacB gene will be used for: - Answer -A) Directional selection of recombinant molecules. B) Killing E. coli cells with non -recombinant plasmids. Which of the following sentences is NOT true: - Answer -A) Plasmids can be used to express heterologous genes in a different genetic background. Correct B)Plasmids can be used to transform a Prokaryotic cell into a Eukaryotic cell. C) Plasmids (called shuttle vectors) can be used to transfer genetic information from Gram negative cells to Gram positives. D) A plasmid expressing GFP will make the recipient strain fluoresce green when exposed to UV light. The best technique used to quickly purify individual DNA fragments from a mixture is___________. - Answer -Removing the DNA bands from a gel, melting the agarose and recovering the DNA with a column. During the plasmid extraction process several solutions are used to disrupt the cells and purify the nucleic acids. The process usually generates some degree of fragmentation in the extracted plasmids. Which of those three forms is assumed to be the native form (or biological form) inside the cells cytoplasm? - Answer -Circular supercoiled The liquid used to fill the running tank is_________? - Answer -Ionic buffer Select the correct sequence of events that take place during PCR amplification. - Answer -full denaturation - denaturation - annealing (primer dependent) - extension (fragment length dependent) - full extension Which of the following is the correct name of the machine used to perform polymerase chain reactions? - Answer -Thermocycler Correct Reverse primer 5'ATGATGATGATGATGATGCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT - Answer -
5'AGGAGGAGGAGGAGG This Figure shows the target sequence with two colors; blue for the positive strand and black for the negative. The primers are depicted as usual; red for the complementary region and green for extra sequences. To which strand will the red portion of the REVERSE primer hybridize with? - Answer -Blue strand Which component is missing in this PCR mixture: polymerase - buffer - forward primer - reverse primer - magnesium - dNTPs and ___________? - Answer -Target sequence

Written for

Institution
AMCB 2023
Course
AMCB 2023

Document information

Uploaded on
March 19, 2024
Number of pages
5
Written in
2023/2024
Type
Exam (elaborations)
Contains
Questions & answers

Subjects

  • amcb 2023 tes
$5.99
Get access to the full document:

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Get to know the seller
Seller avatar
joyrisper

Get to know the seller

Seller avatar
joyrisper Walden University
View profile
Follow You need to be logged in order to follow users or courses
Sold
-
Member since
2 year
Number of followers
0
Documents
103
Last sold
-

0.0

0 reviews

5
0
4
0
3
0
2
0
1
0

Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions