Module 2 Exam Practice 113 Questions with Verified Answers,100% CORRECT
Module 2 Exam Practice 113 Questions with Verified Answers What does RNA Pol I transcribe? - CORRECT ANSWER rRNA What does RNA Pol II transcribe? - CORRECT ANSWER mRNA snRNA What does RNA Pol III transcribe? - CORRECT ANSWER tRNA rRNA snRNA What is wrong with this definition of a gene? "A gene consists of DNA sequences that encode a single polypeptide" - CORRECT ANSWER 1. Not all genes are DNA sequences (RNA viruses) 2. Not all RNA molecules encode for a single polypeptide List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: -Attachment of snRNP U1 to the 5' splice site -Transesterification reaction at the branch point adenine -Transcription of the DNA template into the pre-mRNA molecule -Recognition and binding the 3' AAUAAA sequence by specific protein factors -Cleavage at the poly(A) site -Addition of the 5' cap -Export to the cytoplasm -Addition of the poly(A) tail -Release of lariat structure -Splicing together of exons - CORRECT ANSWER -Transcription of the DNA template into the pre-mRNA molecule -Addition of the 5' cap -Recognition and binding the 3' AAUAAA sequence by specific protein factors -Cleavage at the poly(A) site -Addition of the poly(A) tail -Attachment of snRNP U1 to the 5' splice site -Transesterification reaction at the branch point adenine -Release of lariat structure -Splicing together of exons -Export to the cytoplasm What is meant by the term exon shuffling? - CORRECT ANSWER The functional regions of genes in eukaryotes consist of collections of exons originally present in ancestral genes that are brought together through various recombination events over time. Briefly define transformation and describe the relationship between the phenomenon of transformation and the discovery that DNA is the genetic material in bacteria. - CORRECT ANSWER Transformation is the process whereby one organism is genetically altered by exposure to DNA from another organism. Since DNA can carry heritable "traits" from one organism to another, it must be the genetic material. The finding that virtually all organisms use the same genetic code provides the basis for declaring that the code is universal. Name one exception to such universality. - CORRECT ANSWER the use of codon UGA to code for tryptophan instead of termination in human and yeast mitochondrial DNA Supercoiling caused by unwinding of the dsDNA molecule is relieved by what enzyme? - CORRECT ANSWER DNA gyrase In eukaryotic replication, there is another fundamental level of complexity because of what proteins? - CORRECT ANSWER histones This molecule is synthesized using nucleotides containing the bases adenine, guanine, cytosine, and uracil. a. RNA only b. DNA only c. both RNA and DNA d. neither RNA nor DNA - CORRECT ANSWER A What does it mean to say that double-stranded nucleic acids are antiparallel? - CORRECT ANSWER The C-5' to C-3' orientations run in opposite directions. List 3 requirements of any substance that is "genetic material" - CORRECT ANSWER Replication Expression Variation by mutation List the components of a nucleosome. Be sure to list specific protein, not just protein type. - CORRECT ANSWER Composed of two turns of DNA wrapped around a set of 8 proteins called histones. Each histone is composed of two copies of each of the histone proteins H2A, H2B, H3, and H4 What is the name of the replication unit in prokaryotes, and how does it differ in eukaryotes? - CORRECT ANSWER Replicon. Prokaryotes have one and eukaryotes have many This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates. - CORRECT ANSWER semiconservative replication What are the two major components of the Tobacco Mosaic Virus? - CORRECT ANSWER RNA and protein The genetic code is fairly consistent among all organisms. The term often used to describe such consistency in the code is - CORRECT ANSWER Universal What is the function of the TATA binding protein? - CORRECT ANSWER Allows eukaryotic RNA polymerase II to bind to the promoter of genes How do centromeres help control the cell cycle? - CORRECT ANSWER by inhibiting anaphase until spindle fibers are attached to chromosomes What is the function of eukaryotic RNA polymerase I? - CORRECT ANSWER transcription of rRNA genes When scientists were attempting to determine the structure of the genetic code, Crick and co-workers found that when three base additions or three base deletions occurred in a single gene, the wild-type phenotype was sometimes restored. These data supported the hypothesis that - CORRECT ANSWER the code is triplet Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes? - CORRECT ANSWER double-stranded, antiparallel, (A + T)/C + G) = variable, (A + G)/(C+ T) = 1.0 The β chain of adult hemoglobin is composed of 146 amino acids of a known sequence. In comparing the normal β chain with the β chain in sickle cell hemoglobin, what alteration is one likely to find? - CORRECT ANSWER valine instead of glutamic acid in the sixth position The primary structure of a protein is determined by - CORRECT ANSWER the sequence of amino acids The one-gene, one-enzyme hypothesis emerged from work on which two organisms? - CORRECT ANSWER Neurospora and Drosophila Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction? - CORRECT ANSWER DNA polymerase III DNA polymerase I is thought to add nucleotides - CORRECT ANSWER in the place of the primer RNA after it is removed That some organisms contain much larger amounts of DNA than are apparently "needed" and that some relatively closely related organisms may have vastly different amounts of DNA is more typical in - CORRECT ANSWER eukaryotes than in prokaryotes. Which of the following statements best describes the messenger RNA? -mRNA is synthesized by ribosomes in the endoplasmatic reticulum -genetic information is permanently stored in mRNA -mRNA is the only type of RNA that carries DNA's protein building instructions -mRNA molecules have a double-helix structure -mRNA consists of an anti-codon and an amino acid - CORRECT ANSWER mRNA is the only type of RNA that carries DNA's protein building instructions DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? - CORRECT ANSWER a ribose sugar The genetic code is said to be triplet, meaning that - CORRECT ANSWER there are three bases in mRNA that code for an amino acid. What is the chromosomal configuration of the phiX174 virus? - CORRECT ANSWER single-stranded circular DNA Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that -genetic material must contain complex coding information -genetic material must encode the phenotype. -genetic material must replicate faithfully. -genetic material must be composed of many different units to account for the variability seen in nature. - CORRECT ANSWER genetic material must be composed of many different units to account for the variability seen in nature. What are the 3 classes of "functional" RNAs? Describe them - CORRECT ANSWER tRNA: brings the correct amino acid to the mRNA during translation rRNA: major component of ribosomes snRNA: helps process RNA transcripts, including removing introns Describe the role of the various types of nucleic acids in the storage and expression of information in living organisms. - CORRECT ANSWER Information contained in the base sequences of DNA is transcribed into a variety of RNAs. Certain RNAs (tRNA) carry amino acids to the site of translation where proteins are assembled. Other RNAs (mRNA and rRNA) provide a mechanism for ordering the sequence of amino acids in proteins. What 4 nucleotides make up RNA? - CORRECT ANSWER Adenine Uracil Guanine Cytosine Electrophoretic separation of HbA from HbS is based on a difference in their ________. - CORRECT ANSWER charge Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? A: GTATTAGAACATCTC CATAATCTTGTAGAG B: TGAGCGTTCCAGCAG ACTCGCAAGGTCGTC - CORRECT ANSWER DNA molecule B DNA molecule B has a higher G-C content DNA molecule A has a higher A-T content What is meant by the term antiparallel? - CORRECT ANSWER DNA strands run in opposite directions. One runs 3' to 5' and one runs 5' to 3'. In transcription, nucleotides are always added to the _____end of the elongating strand. - CORRECT ANSWER 3' As unwinding of the helix occurs during DNA replication, tension is created ahead of the replication fork. What is the term for the nature of this tension? What enzyme resolves this tension? - CORRECT ANSWER Supercoiling DNA gyrase What term is used to describe genetic exchange at equivalent positions along two chromosomes with substantial DNA sequence homology? - CORRECT ANSWER general or homologous recombination Why does DNA polymerase III exist as a dimer? - CORRECT ANSWER it acts on both strands that are being replicated simultaneously If A + G/T + C equals 0.5 in one strand, what is the ratio of these bases in the complementary strand? - CORRECT ANSWER 2.0 Short "bursts" of DNA synthesis on the lagging strand produce ___________. - CORRECT ANSWER Okazaki fragments In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction. - CORRECT ANSWER aminoacyl tRNA, A, P, ribosome In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exists. What is it called, and what types of elements are involved? -moderately repetitive DNA, SINEs, LINEs, and VNTRs -permissive DNA, centromeres and heterochromatin -dominant DNA, euchromatin and heterochromatin -multiple gene family DNA, hemoglobin and 5.0S RNA -composite DNA, telomeres and heterochromatin - CORRECT ANSWER moderately repetitive DNA, SINEs, LINEs, and VNTRs You are producing a heteropolymer of synthetic mRNA using a 1C:5G ratio. In this synthetic mRNA what is the proportion of codons with 2Gs and 1C? - CORRECT ANSWER 75/216 Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes? -random point of initiation, bidirectional, semiconservative -random point of initiation, unidirectional, semiconservative -fixed point of initiation, bidirectional, conservative -fixed point of initiation, bidirectional, semiconservative -fixed point of initiation, unidirectional, conservative - CORRECT ANSWER fixed point of initiation, bidirectional, semiconservative The anticodon on the tRNA molecule: -binds to the mRNA in a complementary fashion. -is a catalytic part of protein synthesis. -is the same for all tRNA molecules. -is oriented and written in the 5'→ 3' direction. -contains amino-acyl-tRNA synthtase. - CORRECT ANSWER binds to the mRNA in a complementary fashion. Viral chromosomes exist in a variety of structures and can be made up of the following; -RNA only -DNA or RNA -protein or lipid-coding sequences -DNA only -DNA, RNA, or protein - CORRECT ANSWER DNA or RNA In E. coli, the genetic material is composed of -RNA and protein. -circular, double-stranded RNA. -linear, double-stranded DNA. -polypeptide chains. -circular, double-stranded DNA. - CORRECT ANSWER circular, double-stranded DNA. Which of the sequences could form a hairpin? :CGCCAAAAAATCGCCCCCCAATTA :ATTATTTCGTACCCCCAATTTT :TTCAATAATCGCTAATAACTGA :ATTAGGCCCTACCGCCAATTTT :TTACGGCGGTTCCGCCGGTG :GCCGCCGCCGCCCCATTATTATTAT - CORRECT ANSWER ATTATTTCGTACCCCCAATTTT Which of the following enzymes are known to be involved in the replication of DNA in bacteria? -RNA Polymerase II -RNA primase -ligase -DNA Polymerase I -DNA Polymerase II - CORRECT ANSWER Ligase RNA primase What enzyme is exploited to produce synthetic mRNAs? -ligase -polynucleotide kinase -RNA polymerase II -polynucleotide phosphorylase - CORRECT ANSWER polynucleotide phosphorylase Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are -called heterochromatin and euchromatin. -void of introns. -each void of typical protein-coding sequences of DNA. -uniform in the genetic information they contain. -separated by large stretches of repetitive DNA - CORRECT ANSWER called heterochromatin and euchromatin. Hairpins are formed in DNA as a result of -sequences on the opposite strand that are complementary -sequences on the same strand that are inverted and complementary -sequences on the opposite strand that are identical -sequences on the same strand that are identical - CORRECT ANSWER sequences on the same strand that are inverted and complementary An intron is a section of -protein that is clipped out post-translationally. -RNA that is removed during RNA processing. -DNA that is removed during DNA processing. -carbohydrate that serves as a signal for RNA transport. -transfer RNA that binds to the anticodon. - CORRECT ANSWER RNA that is removed during RNA processing. In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? -Endoplasmic Reticulum -Nucleus -Golgi apparatus -Cytoplasm -Mitochondia - CORRECT ANSWER Nucleus Telomeres________________the end of chromosomes -destabilize -stabilize -replicate -transcribe - CORRECT ANSWER stabilize The discovery of RNA self-splicing by T. Cech (1982) and others in Tetrahymena revealed that RNA can demonstrate autonomous catalytic properties. RNAs that undergo such splicing are often called ________. - CORRECT ANSWER Ribozymes Below is a list of several phenomena relating to protein structure. Clearly describe each phenomenon, the conditions under which each occurs, and the probable influence each has on protein structure. - Hydrophobic interactions - Hydrogen bonds - Disulfide bridges - CORRECT ANSWER -Hydrophobic interactions: Nonpolar side chains of amino acids tend to associate to form hydrophobic clusters away from the surface of the protein -Hydrogen bonds: weak bonds between a hydrogen and an electronegative molecule, these bonds may occur between the components of the peptide bond, side chains, or a combination of the two. They are responsible for helical and pleated sheet structures of proteins. -Disulfide bridges: covalent bonds formed between two cysteine side chains, are strong attractive forces between different regions of proteins DNA replication in vivo requires a primer with a free 3' end. What molecular species provides this 3' end, and how is it provided? - CORRECT ANSWER provided by an RNA primer, which is provided by the enzymatic activity of RNA primase RNA differs from DNA in that it: (more than one answer may be correct) -is made in the cytoplasm rather than in the nucleus -all of the above -is usually single-stranded rather than double-stranded -has ribose sugars rather than deoxyribose sugars in its nucleotides -has uracil rather than thymine - CORRECT ANSWER -is usually single-stranded rather than double-stranded -has ribose sugars rather than deoxyribose sugars in its nucleotides -has uracil rather than thymine Antisense oligonucleotides are relatively short stretches of nucleotides (usually about 20 nucleotides long) that are likely to bind with sense RNAs in a given cell. Of what importance might such a material have in human health? - CORRECT ANSWER These can be used in gene therapy. If a certain gene sequence is known to cause a disorder, an oligonucleotide can be synthesized that can bind to the mRNA coded by the sequence and inactivate it. At what approximate wavelengths do DNA, RNA, and proteins maximally absorb light? - CORRECT ANSWER DNA: 260 nm RNA: 260 nm Proteins: 280 nm Of the following three types of nucleic acids-DNA, mRNA, tRNA-which is most likely to contain modified bases? - CORRECT ANSWER tRNA Hershey and chase labeled DNA using this radioactive atom. - CORRECT ANSWER Phosphorus A base at the first position of an anticodon on the tRNA would pair with a base at the ________ position of the mRNA. - CORRECT ANSWER third Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? -use of different transcriptional activators. -differential acetylation of specific histone proteins prior to transcription. -differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. -multiple random mutations within specific exons of the gene. -All of the above. - CORRECT ANSWER differences in pre-mRNA splicing that results in an altered pattern of exon inclusion Which of the following statements about a mammalian messenger RNA are False? -It is synthesized in the nucleus. -None of the above. -It usually contains a cap at the 5' end. -It is translated in the cytoplasm. -It is usually much smaller than the initial transcript (that is copied directly from the gene). - CORRECT ANSWER None of the above In biology, most information flows through which sequence? - CORRECT ANSWER DNA to RNA to Protein What chemical group is found at the 5' end of a DNA molecule? -phosphate group -nitrogenous base -hydroxyl group -sulfate group -dideoxy group -carboxyl group - CORRECT ANSWER Phosphate group Heterochromatin is characterized by all of the following, EXCEPT that it: -is present at centromeres and telomeres. -remains highly condensed throughout the cell cycle. -is present on most of the Y chromosome. -is present all over the inactive X chromosomes in mammals. -contains genes that require high levels of transcription. - CORRECT ANSWER contains genes that require high levels of transcription Structures located at the ends of eukaryotic chromosomes are called - CORRECT ANSWER telomeres In the DNA double helix, -the number of hydrogen bonds between the participating bases is always constant -A pairs with G, and T pairs with C -a purine always pairs with a pyrimidine -disulfide bridges are formed between the two DNA strands -None of the above - CORRECT ANSWER a purine always pairs with a pyrimidine In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? - CORRECT ANSWER nucleus Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for? -peptide bond formation -the manufacture of synthetic RNA for cell-free systems -ribosomal translocation -degradation of RNA -production of ribosomal proteins - CORRECT ANSWER the manufacture of synthetic RNA for cell-free systems Which of the following features distinguishes RNA from DNA? -RNA has a pentose sugar while DNA utilizes a hexose sugar -Unlike RNA, DNA uses a phosphodiester backbone -None of the above -RNA has only pyrimidine bases -DNA has only purine bases - CORRECT ANSWER None of the above Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine? - CORRECT ANSWER 12% Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes: -linkage to histone molecules -excision of introns -union with ribosomes -fusion into circular forms known as plasmids - CORRECT ANSWER excision of introns When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing. -3' base -middle base -5' base - CORRECT ANSWER 3' base What is unusual about the amino acid composition of histones? How is the function of histones related to the amino acid composition? Of which histones are nucleosomes composed? - CORRECT ANSWER Histones contain large amounts of positively charged amino acids such as lysine and arginine. Thus, they can bind electrostatically to the negatively charged phosphate groups of nucleotides. Nucleosomes are composed of all histones except H1. Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures? - CORRECT ANSWER Fragment A likely has a low Gaunosine/Cytosine content than fragment B. Because Guanosine/Cytosine has 3 h-bonds and Adenine/Thymine only has 2 h-bonds, more energy (higher termperature) is required to break apart the G/C rich fragment. The base content of a sample of DNA is as follows: A = 31%, G = 31%, T = 19%, and C = 19%. What conclusion can be drawn from this information? - CORRECT ANSWER the sample of DNA is single-stranded Present two forms of post-translational modification of proteins. - CORRECT ANSWER -Removal or modification of amino acids -Introduction of a new functional group like a phosphate or sugar (phosphorylation and glycosylation, respectively) Assuming that an amino acid sequence is 250 amino acids long, how many different molecules, each with a unique sequence, could be formed? - CORRECT ANSWER 20^250 Which of the following are role(s) of the 5' cap? - CORRECT ANSWER -The cap protects the RNA from degradation. -The cap acts as a binding site for the ribosome. -The cap plays a role in the removal of introns. The 5' cap on an mRNA is important for all the processes listed below except for the ___ of an mRNA molecule. a. transcription b. intron removal c. stability d. initiation of translation - CORRECT ANSWER a. transcription The term peptidyltransferase relates to -5' capping of mRNA. -base additions during mRNA synthesis. -elongation factors binding to the large ribosomal subunit. -discontinuous strand replication. -peptide bond formation during protein synthesis. - CORRECT ANSWER peptide bond formation during protein synthesis The packaging of DNA into a confined space is what level of DNA structure? - CORRECT ANSWER tertiary Introns are known to contain termination codons (UAA, UGA, or UAG), yet these codons do not interrupt the coding of a particular protein. Why? -More than one termination codon is needed to stop translation. -Introns are removed from mRNA before translation. -Exons are spliced out of mRNA before translation. -These triplets cause frameshift mutations, but not termination. -UAA, UGA, and UAG are initiator codons, not termination codons. - CORRECT ANSWER Introns are removed from mRNA before translation. Considering the structure of double-stranded DNA, what kinds of bonds hold one complementary strand to the other? -van der Waals -hydrophobic and hydrophilic -covalent -ionic -hydrogen - CORRECT ANSWER hydrogen In the classic experiment conducted by Hershey and Chase, why was the pellet radioactive in the centrifuge tube that contained bacteria with viruses, which had been grown on medium containing 32P? -The radioactive viruses were in the pellet, and the bacteria were in the supernatant. -The radioactive viruses (coats plus DNA) were in the pellet. -The radioactive protein coats of the viruses were in the pellet. -The bacteria were in the pellet, and many contained the radioactive viral DNA. -The bacteria were in the pellet, and they had incorporated radioactive proteins into their cell membranes. - CORRECT ANSWER The bacteria were in the pellet and many contained the radioactive viral DNA Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes -union with ribosomes -linkage to histone molecules -excision of introns -fusion into circular forms known as plasmids - CORRECT ANSWER excision of introns DNA polymerase III adds nucleotides -to the 5' end of the RNA primer. -in the place of the primer RNA after it is removed. -to internal sites in the DNA template. -to both ends of the RNA primer. -to the 3' end of the RNA primer. - CORRECT ANSWER to the 3' end of the RNA primer Reverse transcriptase is an enzyme found in association with retroviral activity. It has the property of -synthesis of RNA from a DNA template. -requiring no template. -synthesis of DNA from an RNA template. -most lysozymes. -translation. - CORRECT ANSWER synthesis of DNA from an RNA template Which is a characteristic of DNA sequences at the telomeres? -One strand protrudes beyond the other, creating some single-stranded DNA at the end. -The consist of repeated sequences -all choices are correct -They consist of cytosine and adenine nucleotides - CORRECT ANSWER all choices are correct The relationship between codon and anticodon can be characterized as involving ________ between complementary bases (usually) in typical ________ fashion. -ionic bonds, antiparallel -covalent bonds, parallel -hydrogen bonds, parallel -hydrogen bonds, antiparallel -covalent bonds, antiparallel - CORRECT ANSWER Hydrogen bonds, antiparallel The discontinuous aspect of replication of DNA in vivo is caused by -trinucleotide repeats. -polymerase slippage. -sister-chromatid exchanges. -topoisomerases cutting the DNA in a random fashion. -the 5' to 3' polarity restriction. - CORRECT ANSWER the 5' to 3' polarity restriction Which of the following statements about the genetic code are true? -None of the above -Most amino acids are encoded by more than one codon -There is only one codon for each amino acid -Two consecutive bases specify an amino acid -The code is ambiguous but not redundant - CORRECT ANSWER Most amino acids are encoded by more than one codon A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will -serve as the initiation codon. -encode methionine that will eventually be removed. -encode N-formylmethionine. -encode unformylated methionine. - CORRECT ANSWER encode methionine that will eventually be removed. Which of the following are among the major components of prokaryotic ribosomes? -18S rRNA, 5.8S rRNA, and proteins -16S rRNA, 5.8S rRNA, and 28S rRNA -16S rRNA, 5S rRNA, and 23S rRNA -lipids and carbohydrates -12S rRNA, 5.8S rRNA, and proteins - CORRECT ANSWER 16S rRNA, 5S rRNA, and 23S rRNA Translation is directly dependent on all of the following associations except _______. -association of the 30S and the 50S ribosomal subunits -complementary base pairing between mRNA and rRNA -complementary base pairing between mRNA and tRNA -complementary base pairing between mRNA and DNA - CORRECT ANSWER complementary base pairing between mRNA and DNA In 1964, Nirenberg and Leder used the triplet binding assay to determine specific codon assignments. A complex of which of the following components was trapped in the nitrocellulose filter? -ribosomes and DNA -uncharged tRNAs and ribosomes sense and antisense strands of DNA -free tRNAs -charged tRNA, RNA triplet, and ribosome - CORRECT ANSWER charged tRNA, RNA triplet, and ribosome What is the name of the precursor molecule used in nucleic acid synthesis (do not give an abbreviation)? - CORRECT ANSWER nucleoside triphosphate Regarding the efficient initiation of transcription by RNA polymerase II, what specific "upstream" signals appear to be involved? - CORRECT ANSWER TATA and CAAT base sequences, and enhancers Referring to the genetic code, what is meant by "wobble"? - CORRECT ANSWER third codon in anticodon of tRNA interacts with more than one codon of mRNA This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them. - CORRECT ANSWER DNA ligase What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli. -that protein was the genetic material in phage -that somehow the radioactivity prevented DNA from getting into E. coli -that protein and DNA together made up the genetic material -that DNA was the genetic material in phage - CORRECT ANSWER that protein was the genetic material in phage The ribonucleic acid components known to exist in eukaryotic ribosomes are the following: (check all that apply) -5.8S -5S -18S -28S -16S - CORRECT ANSWER 5S 5.8S 18S 28S What is the function of peptidyl transferase activity? -It charges tRNAs. -it cleaves the polypeptide from the last tRNA during termination. -It acetylates the end of a protein after translation. -it forms peptide bonds. -It moves ribosomes along mRNA during translation. - CORRECT ANSWER it forms peptide bonds
Written for
- Institution
- Module 2
- Module
- Module 2
Document information
- Uploaded on
- February 4, 2024
- Number of pages
- 19
- Written in
- 2023/2024
- Type
- Exam (elaborations)
- Contains
- Questions & answers
Subjects
-
module 2 exam practice 113 questions with answers