• Wrong document? Swap it for free
  • Written by students who passed
  • Immediately available after payment
  • Read online or as PDF
  • 4.6 TrustPilot
0
Sell
Where do you study
Your language
Start selling Create your account
  • Mbascp
  • Mbascp
To add items to your wishlist, you must be logged in
Document preview thumbnail
Preview 1 out of 2 pages
Exam (elaborations)

MB ASCP Demo Practice Exam Questions

0.0
(0 reviews)
- sold
2 pages
2022/2023 Written for academic year
Institution Mbascp
Course Mbascp
Document preview thumbnail
Preview 1 out of 2 pages

MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C 3. What assay amplifies the target using a combination of a three-enzyme system? A. Branched DNA B. TMA C. PCR D. NASBA E. LCR - ANSWERD. NASBA 4. All of the following enzymes are part of the DNA replication machinery, EXCEPT: A. Ligase B. DNA polymerase C. Luciferase D. Helicase - ANSWERC. Luciferase 5. In real-time PCR, what is amplified? A. The target B. The signal C. The probe D. All of the above - ANSWERA. The target 6. All of the following are components of nucleic acids, EXCEPT: A. Phosphate group B. Sugar (ribose or deoxyribose) C. Nitrogenous base (A, G, C, T) D. Formamide - ANSWERD. Formamide

Document information

Uploaded on
June 10, 2023
Number of pages
2
Written in
2022/2023
Type
Exam (elaborations)
Contains
Questions & answers
Report Copyright Violation
$8.49
Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF
Seller avatar
AMINAHASSAN001
3.0
(1)
Sold
5
Followers
3
Items
458
Last sold
1 year ago

Browse related subjects

Subjects

  • in real time pcr
  • which of th
  • mb ascp demo practice exam questions
  • what assay amplifies the target using a combinatio
  • all of the following enzymes are part of the dna r
  • what is amplified a the targe

Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Learn more Create citation
Working on your references?

Frequently asked questions

Whoops! We can’t load your doc right now. Try again or contact support.