• Wrong document? Swap it for free
  • Written by students who passed
  • Immediately available after payment
  • Read online or as PDF
Sell
Where do you study
Your language
Document preview thumbnail
Preview 1 out of 4 pages
Exam (elaborations)

BIO 325 Genetics Problem Set 4 Questions and Answers 2026/27 Latest - UT Austin

Document preview thumbnail
Preview 1 out of 4 pages

BIO 325 Genetics Problem Set 4 Questions and Answers 2026/27 Latest - UT Austin

Content preview

BIO 325 Genetics Problem Set 4 Questions and Answers 2026/27 Latest - UT
Austin
1. This is a Sanger sequence as seen by running the reaction with dideoxynucleotides in 4 separate tubes
and running the reactions out in 4 lanes of a sequencing gel. Shown in parallel is the same result as it
would be seen through a sequencing machine. A. Write the sequence out 5’ to 3’ and show where the
primer is. Write out the sequence of the template strand 5’-3’

Sequencing result 5’ primer ATAAAAAACTCAGAACGGCTTCGTA3’

[ 3’ TATTTTTTGAGTCTTGCCGAAGCAT 5’ ]

Template strand 5’ TACGAAGCCGTTCTGAGTTTTTTAT 3’
3’ Last base added




Flow of bases

through the gel




First base added to primer
5’
2. Three required elements of a plasmid are all of the following except:

A. An origin of replication
B. An antibiotic resistance gene
C. A multicloning (polylinker) site
D. A beta galactosidase gene

3. Seymore Benzer generated a number of mutants that
gave different lengths of the same protein. He looked at the
amino acid that should have come next after the point of
truncation and discovered they all had something in
common.They could all be converted by one point mutation to
the same codon. That codon was …

A. UAG
BIO 325 Genetics Problem Set 4

Document information

Uploaded on
September 27, 2026
Number of pages
4
Written in
2026/2027
Type
Exam (elaborations)
Contains
Questions & answers
$16.49

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
DynamicNurse
4.0
(566)
Sold
3893
Followers
2915
Items
1983
Last sold
1 day ago




Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their tests and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can instantly pick a different document that better fits what you're looking for.

Pay as you like, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Working on your references?

Create accurate citations in APA, MLA and Harvard with our free citation generator.

Working on your references?

Frequently asked questions