BIO 101 NVCC CORRECT FINAL EXAMS
QUESTIONS AND ANSWERS RATED A+
✔✔If a trait is equally as likely to be inherited by males as females, it is ________ -
✔✔autosomal
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism. The genotype of the child can be: - ✔✔aa
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism. The genotype of the mother is: - ✔✔Aa
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism.
The probability that their next child is a carrier (heterozygous) is: - ✔✔2/4
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism.
The probability that their next child has albinism is: - ✔✔1/4
✔✔Having freckles is an autosomal dominant trait. A man without freckles has a child
with a woman has freckles. The woman's mother does not have freckles.
The chance that they will have a child with freckles is: - ✔✔2/4
✔✔Having freckles is an autosomal dominant trait. A heterozygous couple who both
have freckles, have a _____ chance of having a child without freckles: - ✔✔1/4
, ✔✔Pedigrees show the pattern of inheritance of several genetic disorders within a
family. True or false? - ✔✔False
✔✔In pedigrees, squares represent females. True or false? - ✔✔False
✔✔If the phenotype of the heterozygote is intermediate between the homozygous
parents, it is probably an incomplete dominant trait.. True or false? - ✔✔True
✔✔A blood type A person can donate blood to someone who is blood type AB. True or
false? - ✔✔True
✔✔Helicase: - ✔✔unwinds the DNA double helix
✔✔Ligase: - ✔✔joins DNA fragments together
✔✔RNA Primer - ✔✔RNA piece requuired to get DNA Polymerase started
✔✔This strand discontinuously builds new DNA - ✔✔Lagging
✔✔Anti-Parralel DNA strands - ✔✔One DNA strand runs 3' to 5' while the other runs 5'
to 3'
✔✔Okasaki fragments - ✔✔short pieces of DNA on the lagging strand
✔✔DNA polymerase - ✔✔Adds/builds new DNA in a 5' to 3' direction
✔✔This strand continuously builds new DNA - ✔✔Leading
✔✔Semi-Converative replication is - ✔✔the new DNA double helix has one old strand
and one new strand
✔✔Complementary DNA base pairing for DNA Replication - ✔✔A-T, C-G
✔✔Give the complementary sequence of DNA on the opposite strand - and label the 5'
and 3' end:
3' CATTAGAAGCTAAAGCGCTATAT 5' - ✔✔5' GTAATCTTCGATTTCGCGATATA 3'
✔✔Original DNA strand: 5 ' ATACAGATTAACCGG
_________________________________ REPLICATION FORK moving to the right
QUESTIONS AND ANSWERS RATED A+
✔✔If a trait is equally as likely to be inherited by males as females, it is ________ -
✔✔autosomal
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism. The genotype of the child can be: - ✔✔aa
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism. The genotype of the mother is: - ✔✔Aa
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism.
The probability that their next child is a carrier (heterozygous) is: - ✔✔2/4
✔✔Albinism is an autosomal recessive trait. A man and a woman who are both wild
type, have a child with albinism.
The probability that their next child has albinism is: - ✔✔1/4
✔✔Having freckles is an autosomal dominant trait. A man without freckles has a child
with a woman has freckles. The woman's mother does not have freckles.
The chance that they will have a child with freckles is: - ✔✔2/4
✔✔Having freckles is an autosomal dominant trait. A heterozygous couple who both
have freckles, have a _____ chance of having a child without freckles: - ✔✔1/4
, ✔✔Pedigrees show the pattern of inheritance of several genetic disorders within a
family. True or false? - ✔✔False
✔✔In pedigrees, squares represent females. True or false? - ✔✔False
✔✔If the phenotype of the heterozygote is intermediate between the homozygous
parents, it is probably an incomplete dominant trait.. True or false? - ✔✔True
✔✔A blood type A person can donate blood to someone who is blood type AB. True or
false? - ✔✔True
✔✔Helicase: - ✔✔unwinds the DNA double helix
✔✔Ligase: - ✔✔joins DNA fragments together
✔✔RNA Primer - ✔✔RNA piece requuired to get DNA Polymerase started
✔✔This strand discontinuously builds new DNA - ✔✔Lagging
✔✔Anti-Parralel DNA strands - ✔✔One DNA strand runs 3' to 5' while the other runs 5'
to 3'
✔✔Okasaki fragments - ✔✔short pieces of DNA on the lagging strand
✔✔DNA polymerase - ✔✔Adds/builds new DNA in a 5' to 3' direction
✔✔This strand continuously builds new DNA - ✔✔Leading
✔✔Semi-Converative replication is - ✔✔the new DNA double helix has one old strand
and one new strand
✔✔Complementary DNA base pairing for DNA Replication - ✔✔A-T, C-G
✔✔Give the complementary sequence of DNA on the opposite strand - and label the 5'
and 3' end:
3' CATTAGAAGCTAAAGCGCTATAT 5' - ✔✔5' GTAATCTTCGATTTCGCGATATA 3'
✔✔Original DNA strand: 5 ' ATACAGATTAACCGG
_________________________________ REPLICATION FORK moving to the right
