Module #2 Exam WITH APPROVED QUESTIONS AND ANSWERS |LATEST
UPLOAD |GRADED A+
2 types of small RNA molecules involved in gene regulation? - correct answer-siRNAs and
miRNAs
An organism has a A + T content of 64%. What is the percentage for C? - correct answer-18
An organism has a T content of 22%. What is the percentage for C? - correct answer-28
This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond
between them. - correct answer-DNA ligase
"5'...GGAGCUCGUUGUAUU...3'
Is this sequence RNA or DNA? How can you tell?" - correct answer-RNA because DNA does
not contain uracil
Meselson-Stahl Experiment, what hypothetical form of DNA replication results in the same
DNA density distribution as the semiconservative method after the first cell division, but
was not supported upon the second cell division? - correct answer-Dispersive replication
The bonds that connect nucleotides in a strand are call _________ bonds. - correct answer-
Phosphodiester
Can RNA act as genetic material, if so name one ex of an organisms - correct answer-Yes,
retrovirus
Type the complementary strand to the following single-stranded DNA.
5' - ATAGCATGGGCCATACGATTACTGA - 3' - correct answer-3'
TATCGTACCCGGTATGCTAATGACT 5'
This organic subunit is the monomer from which nucleic acid is formed - correct answer-
Nucleotide, per EA
Hershey and chase labeled DNA using this radioactive atom. - correct answer-Phosphorus
,In Eukaryotic replication there is a fundamental level of complexity because of what
proteins? - correct answer-Histone proteins
This Greek letter describes the shape of a bacterial chromosome mid-way through
replication. - correct answer-Theta
The nitrogenous base of a nucleotide may be of two types - a purine or a pyrimidine.
Adenine________
Uracil________
Guanine _____________
Thymine____________
Cytosine__________ - correct answer-Purine
Pyrmidine
Purine
Pyrmidine
Pyrmidine
Uracil contains________as sugar. - correct answer-Ribose
This term describes the sequence of nucleotides which direct the formation of a new
nucleic acid strand. - correct answer-Parent strand per EA
Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5'
UCG 3', considering wobble-base pairing rules. - correct answer-3' ACG 5' (exact)
Wobbe codons: 3' ACC 5', 3' ACU 5', 3' ACA 5'
This new strand of DNA has its 3' end oriented in the opposite direction as that in which the
replication fork travels. - correct answer-Lagging strand
This new strand of DNA has its 3' end oriented in the same direction as the replication fork
travels. - correct answer-Leading strand
The concept that genetic information passes from DNA to RNA to protein is called - correct
answer-The central dogma
, While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to
set up a condition where DNA polymerase can then take over for replication. - correct
answer-Primase
RNA polymerase must bind to a region of DNA called a(n) __________ in order to begin
transcription. - correct answer-Promoter
List 3 requirements of any substance that be a "genetic material" - correct answer-
Replication
Storage
Expression
This method of replication preserves the covalent links on one strand of DNA but allows
permanent separation of the "parental" double helix to form two templates. - correct
answer-Semiconservative replication
What is semiconservative replication ? - correct answer-Each of the parent nucleotide
strands remains intact (conserved), but they are now bound to new nucleotide strands
instead of each other.
In transcription, nucleotides are always added to the _____end of the elongating strand. -
correct answer-3'
Whereas the nucleotide strand used for transcription is termed the____________ the
nontranscribed strand is called the _____________ . - correct answer-Template strand
Nontemplate strand
Eukaryotes have two of these per chromosome; prokaryotes have none. - correct answer-
Telomeres
Short "bursts" of DNA synthesis that establish the lagging strand are called these. - correct
answer-Okazaki fragments
An organism has a G content of 32%, what is the % A? - correct answer-18
Kornberg, in his experiments to demonstrate the function of DNA polymerase I, sought to
show that DNA Pol 1 was capable of replicating biologically active DNA. What is the
definition of biologically active DNA in this context? - correct answer-Biologically active
UPLOAD |GRADED A+
2 types of small RNA molecules involved in gene regulation? - correct answer-siRNAs and
miRNAs
An organism has a A + T content of 64%. What is the percentage for C? - correct answer-18
An organism has a T content of 22%. What is the percentage for C? - correct answer-28
This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond
between them. - correct answer-DNA ligase
"5'...GGAGCUCGUUGUAUU...3'
Is this sequence RNA or DNA? How can you tell?" - correct answer-RNA because DNA does
not contain uracil
Meselson-Stahl Experiment, what hypothetical form of DNA replication results in the same
DNA density distribution as the semiconservative method after the first cell division, but
was not supported upon the second cell division? - correct answer-Dispersive replication
The bonds that connect nucleotides in a strand are call _________ bonds. - correct answer-
Phosphodiester
Can RNA act as genetic material, if so name one ex of an organisms - correct answer-Yes,
retrovirus
Type the complementary strand to the following single-stranded DNA.
5' - ATAGCATGGGCCATACGATTACTGA - 3' - correct answer-3'
TATCGTACCCGGTATGCTAATGACT 5'
This organic subunit is the monomer from which nucleic acid is formed - correct answer-
Nucleotide, per EA
Hershey and chase labeled DNA using this radioactive atom. - correct answer-Phosphorus
,In Eukaryotic replication there is a fundamental level of complexity because of what
proteins? - correct answer-Histone proteins
This Greek letter describes the shape of a bacterial chromosome mid-way through
replication. - correct answer-Theta
The nitrogenous base of a nucleotide may be of two types - a purine or a pyrimidine.
Adenine________
Uracil________
Guanine _____________
Thymine____________
Cytosine__________ - correct answer-Purine
Pyrmidine
Purine
Pyrmidine
Pyrmidine
Uracil contains________as sugar. - correct answer-Ribose
This term describes the sequence of nucleotides which direct the formation of a new
nucleic acid strand. - correct answer-Parent strand per EA
Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5'
UCG 3', considering wobble-base pairing rules. - correct answer-3' ACG 5' (exact)
Wobbe codons: 3' ACC 5', 3' ACU 5', 3' ACA 5'
This new strand of DNA has its 3' end oriented in the opposite direction as that in which the
replication fork travels. - correct answer-Lagging strand
This new strand of DNA has its 3' end oriented in the same direction as the replication fork
travels. - correct answer-Leading strand
The concept that genetic information passes from DNA to RNA to protein is called - correct
answer-The central dogma
, While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to
set up a condition where DNA polymerase can then take over for replication. - correct
answer-Primase
RNA polymerase must bind to a region of DNA called a(n) __________ in order to begin
transcription. - correct answer-Promoter
List 3 requirements of any substance that be a "genetic material" - correct answer-
Replication
Storage
Expression
This method of replication preserves the covalent links on one strand of DNA but allows
permanent separation of the "parental" double helix to form two templates. - correct
answer-Semiconservative replication
What is semiconservative replication ? - correct answer-Each of the parent nucleotide
strands remains intact (conserved), but they are now bound to new nucleotide strands
instead of each other.
In transcription, nucleotides are always added to the _____end of the elongating strand. -
correct answer-3'
Whereas the nucleotide strand used for transcription is termed the____________ the
nontranscribed strand is called the _____________ . - correct answer-Template strand
Nontemplate strand
Eukaryotes have two of these per chromosome; prokaryotes have none. - correct answer-
Telomeres
Short "bursts" of DNA synthesis that establish the lagging strand are called these. - correct
answer-Okazaki fragments
An organism has a G content of 32%, what is the % A? - correct answer-18
Kornberg, in his experiments to demonstrate the function of DNA polymerase I, sought to
show that DNA Pol 1 was capable of replicating biologically active DNA. What is the
definition of biologically active DNA in this context? - correct answer-Biologically active
