LSUE BIOLOGY 1001 PROFESSIONAL
ASSESSMENT 2026 QUESTION ANSWER
COMPILATION VERIFIED GUIDE
◉ The chromosome theory of inheritance states that
A) chromosomes that exhibit mutations are the source of genetic
variation
B) the behavior of chromosomes during meiosis and fertilization
accounts for patterns of inheritance
C) the behavior of chromosomes during mitosis accounts for
inheritance patterns
D) humans have 46 chromosomes. Answer: B) the behavior of
chromosomes during meiosis and fertilization accounts for patters
of inheritance
◉ The alleles of a gene are found at ______ chromosomes
A) the same locus on non homologous
B) different loci on homologous
C) different loci on non homologous
,D) the same locus on homologous. Answer: D) the same locus on
homologous
◉ DNA polymerase
A) joins nucleotides to produce new polymers of RNA
B) reads the RNA strand, and adds the complementary nitrogen
bases to make new RNA strand
C) Stretches the DNA polymers to make new DNA strands
D) joins the two DNA fragments
E) reads the DNA strands, and adds the complementary nucleotides
to amen a new DNA strand. Answer: E) reads the DNA strands, and
adds the complementary nucleotides to amen a new DNA strand
◉ Why does the recessive allele disorder, such as color blindness,
that is linked to human sex chromosomes X affect mostly males?
Because, it is more likely that
A) females have a greater probability of inheriting two recessive
alleles than one allele to express the disorder
B) males need only one recessive allele from his father to express the
disorder
C) females have a lesser probability of inheriting one recessive allele
than two alleles to express the disorder
,D) males need two recessive alleles from the father and the mother
to express the disorder
E) males need only one recessive allele from his mother to express
the disorder. Answer: E) males need only one recessive allele from
his mother to express the disorder
◉ If a mRNA with nucleotide sequence as shown below is translated,
what should be the right sequence of amino acids in a polypeptide?
Refer to Genetic Code Table and use the 3 letters of amino acids to
form the protein
- 5'AUGUUAAGAGUCCGGAUUUAUGG3'
A) Met Leu Arg Ala Pro Asp Leu Trp
B) Met Leu Trp Leu Arg Ala Pro Asp
C) Met Asp Leu Trp Leu Arg Ala Pro
D) Met Arg Ala Pro Asp Leu Trp Leu
E) Leu Trp Leu Arg Ala Pro Met Asp. Answer:
◉ The directions for each amino acid in a polypeptide are indicated
by a codon that consists of _____ nucleotide(s) in a RNA molecule
A) 5
B) 4
C) 3
, D) 2. Answer: 3
◉ One type of virus that infects bacteria is called a
A) phage
B) mage
C) rhinovirus
D) coronavirus. Answer: A) phage
◉ The copying mechanism of DNA is most like
A) using a photographic negative to make a positive image
B) mixing flour, sugar, and water to make bread dough
C) dripping water out of faucet
D) carving a figure out of wood. Answer: A) using a photographic
negative to make a positive image
◉ Which of the following statements regarding a DNA double helix is
always true?
A) the amount of adenine is equal to the amount of uracil, and the
amount of guanine is equal to the amount of cytosine
ASSESSMENT 2026 QUESTION ANSWER
COMPILATION VERIFIED GUIDE
◉ The chromosome theory of inheritance states that
A) chromosomes that exhibit mutations are the source of genetic
variation
B) the behavior of chromosomes during meiosis and fertilization
accounts for patterns of inheritance
C) the behavior of chromosomes during mitosis accounts for
inheritance patterns
D) humans have 46 chromosomes. Answer: B) the behavior of
chromosomes during meiosis and fertilization accounts for patters
of inheritance
◉ The alleles of a gene are found at ______ chromosomes
A) the same locus on non homologous
B) different loci on homologous
C) different loci on non homologous
,D) the same locus on homologous. Answer: D) the same locus on
homologous
◉ DNA polymerase
A) joins nucleotides to produce new polymers of RNA
B) reads the RNA strand, and adds the complementary nitrogen
bases to make new RNA strand
C) Stretches the DNA polymers to make new DNA strands
D) joins the two DNA fragments
E) reads the DNA strands, and adds the complementary nucleotides
to amen a new DNA strand. Answer: E) reads the DNA strands, and
adds the complementary nucleotides to amen a new DNA strand
◉ Why does the recessive allele disorder, such as color blindness,
that is linked to human sex chromosomes X affect mostly males?
Because, it is more likely that
A) females have a greater probability of inheriting two recessive
alleles than one allele to express the disorder
B) males need only one recessive allele from his father to express the
disorder
C) females have a lesser probability of inheriting one recessive allele
than two alleles to express the disorder
,D) males need two recessive alleles from the father and the mother
to express the disorder
E) males need only one recessive allele from his mother to express
the disorder. Answer: E) males need only one recessive allele from
his mother to express the disorder
◉ If a mRNA with nucleotide sequence as shown below is translated,
what should be the right sequence of amino acids in a polypeptide?
Refer to Genetic Code Table and use the 3 letters of amino acids to
form the protein
- 5'AUGUUAAGAGUCCGGAUUUAUGG3'
A) Met Leu Arg Ala Pro Asp Leu Trp
B) Met Leu Trp Leu Arg Ala Pro Asp
C) Met Asp Leu Trp Leu Arg Ala Pro
D) Met Arg Ala Pro Asp Leu Trp Leu
E) Leu Trp Leu Arg Ala Pro Met Asp. Answer:
◉ The directions for each amino acid in a polypeptide are indicated
by a codon that consists of _____ nucleotide(s) in a RNA molecule
A) 5
B) 4
C) 3
, D) 2. Answer: 3
◉ One type of virus that infects bacteria is called a
A) phage
B) mage
C) rhinovirus
D) coronavirus. Answer: A) phage
◉ The copying mechanism of DNA is most like
A) using a photographic negative to make a positive image
B) mixing flour, sugar, and water to make bread dough
C) dripping water out of faucet
D) carving a figure out of wood. Answer: A) using a photographic
negative to make a positive image
◉ Which of the following statements regarding a DNA double helix is
always true?
A) the amount of adenine is equal to the amount of uracil, and the
amount of guanine is equal to the amount of cytosine