What turn around time should be monitored to assess the effectiveness of a change to the specimen
transport process? - Correct Answer Pre-analytical
What is the total magnification when a smear is viewed using a 15x ocular lens and a 60x objective lens?
- Correct Answer 900
which of the following actions should be performed to achieve proper ergonomics when using a
microtome? - Correct Answer Place microtome so that ares are kept close to the body
which of the following conditions best correlated with an anion gap of 12mmol/L - Correct Answer
normal health
which of the following actions constitutes social caregiving - Correct Answer touching a patients
shoulder to comfort them
which of the following actions may be taken to gather evidence when a new polymerase chain reaction
methodology is being investigated for clinical use? - Correct Answer perform a literature review
what peak is the molecular ion in the given hydrocarbon mass spectrum? - Correct Answer 46
which of the following fixatives should not be used when performing a periodic cid schiffs stain? -
Correct Answer gluteraldehyde
which of the following blood components are most frequently implicated in suspected cases of
transfusion-related acute lung injury - Correct Answer frozen plasma
which is the appropriate action given the control result below?
test QC organism QC result
,PYR Enterococcus faecalis. positive
Streptococcus agalactiae negative - Correct Answer record and report patient results
which of the following actions is a barrier to verbal communication? - Correct Answer using familiar
terminology
which of the following conditions would most likely correlate with the results below?
RBC 2.91x10^12/L
MCV 105 fL
MCHC 398 g/L - Correct Answer cold agglutinins
which of the following actions must occur to a 24 hour urine collection? - Correct Answer discard the
first void
which of the following reagents is used as the mordant and oxidant in the Weigert's Hematoxylin? -
Correct Answer ferric chloride
which of the following actions should be taken when tissue sections stained with hematoxylin and eosin
show pale cytoplasmic staining? - Correct Answer check the pH of the eosin and adjust with acetic acid
if necessary
which of the following is the correct order of actions to take given the quality control results below?
L1 L2 L3
HGB target mean 40 +/- g/L 120 +/- g/L 165 +/- g/L
HGB QC result 38 g/L 109 g/L 130 g/L - Correct Answer repeat QC, assay new controls, use fresh
reagent, recalibrate
which of the following requirements must be included in the setup of laboratory information system? -
Correct Answer identification code and password to each user
, which of the following actions should be taken when a bronchial lavage is received for aerobic and
anaerobic culture? - Correct Answer reject the anaerobic culture
what sequence correlates to the pyrogram? - Correct Answer GTTCGTTGCAACAAATTGAT
which of the following light sources is appropriate for spectrophotometric measurement in the 180 to
350nm range? - Correct Answer hydrogen
which of the following signals is detected in pyrosequencing? - Correct Answer chemiluminescence
which of the following findings explains these results? - Correct Answer anti-A anti-B anti-AB A1 cells B
cells O cells Auto
3+ 0 3+ 2+ 3+ 2+ 2+
which of the following action given the control results below?
test QC organisms QC results
PYR enterococcus faecalis pink
streptococcus agalactiae colourless - Correct Answer record and report patient results
which of the following actions is appropriate of a patient refuses to make eye contact with the
phlebotomist when they are asked to provide their name? - Correct Answer reflect on cultural
differences before proceeding
which of the following statements is consistent with the results given below?
sample type pleural fluid
total nucleated cell count markedly increased
cytospin with Romanowsky stain 85% neutrophils
15% monocytes
transport process? - Correct Answer Pre-analytical
What is the total magnification when a smear is viewed using a 15x ocular lens and a 60x objective lens?
- Correct Answer 900
which of the following actions should be performed to achieve proper ergonomics when using a
microtome? - Correct Answer Place microtome so that ares are kept close to the body
which of the following conditions best correlated with an anion gap of 12mmol/L - Correct Answer
normal health
which of the following actions constitutes social caregiving - Correct Answer touching a patients
shoulder to comfort them
which of the following actions may be taken to gather evidence when a new polymerase chain reaction
methodology is being investigated for clinical use? - Correct Answer perform a literature review
what peak is the molecular ion in the given hydrocarbon mass spectrum? - Correct Answer 46
which of the following fixatives should not be used when performing a periodic cid schiffs stain? -
Correct Answer gluteraldehyde
which of the following blood components are most frequently implicated in suspected cases of
transfusion-related acute lung injury - Correct Answer frozen plasma
which is the appropriate action given the control result below?
test QC organism QC result
,PYR Enterococcus faecalis. positive
Streptococcus agalactiae negative - Correct Answer record and report patient results
which of the following actions is a barrier to verbal communication? - Correct Answer using familiar
terminology
which of the following conditions would most likely correlate with the results below?
RBC 2.91x10^12/L
MCV 105 fL
MCHC 398 g/L - Correct Answer cold agglutinins
which of the following actions must occur to a 24 hour urine collection? - Correct Answer discard the
first void
which of the following reagents is used as the mordant and oxidant in the Weigert's Hematoxylin? -
Correct Answer ferric chloride
which of the following actions should be taken when tissue sections stained with hematoxylin and eosin
show pale cytoplasmic staining? - Correct Answer check the pH of the eosin and adjust with acetic acid
if necessary
which of the following is the correct order of actions to take given the quality control results below?
L1 L2 L3
HGB target mean 40 +/- g/L 120 +/- g/L 165 +/- g/L
HGB QC result 38 g/L 109 g/L 130 g/L - Correct Answer repeat QC, assay new controls, use fresh
reagent, recalibrate
which of the following requirements must be included in the setup of laboratory information system? -
Correct Answer identification code and password to each user
, which of the following actions should be taken when a bronchial lavage is received for aerobic and
anaerobic culture? - Correct Answer reject the anaerobic culture
what sequence correlates to the pyrogram? - Correct Answer GTTCGTTGCAACAAATTGAT
which of the following light sources is appropriate for spectrophotometric measurement in the 180 to
350nm range? - Correct Answer hydrogen
which of the following signals is detected in pyrosequencing? - Correct Answer chemiluminescence
which of the following findings explains these results? - Correct Answer anti-A anti-B anti-AB A1 cells B
cells O cells Auto
3+ 0 3+ 2+ 3+ 2+ 2+
which of the following action given the control results below?
test QC organisms QC results
PYR enterococcus faecalis pink
streptococcus agalactiae colourless - Correct Answer record and report patient results
which of the following actions is appropriate of a patient refuses to make eye contact with the
phlebotomist when they are asked to provide their name? - Correct Answer reflect on cultural
differences before proceeding
which of the following statements is consistent with the results given below?
sample type pleural fluid
total nucleated cell count markedly increased
cytospin with Romanowsky stain 85% neutrophils
15% monocytes
