COCO SOLUTIONS ACADEMIC STORE

microbiota - Answer refers to the organisms themselves ( includes bacteria, viruses, archaea, fungi, and protozoa) microbiome - Answer entire habitat including microorganisms, their genomes, and their surroundings conditions metagenome - Answer collection of genes and genomes from microbiota holobiont - Answer entire host and its microbe symbionts symbiont - Answer different organisms that live together mutualist - Answer host and microbes benefit ...

Meniere's Disease is linked to an excessive volume of endolymph fluid. Where in the ear is endolymph found? A. Outer ear B. Middle ear C. Inner ear D. B and C E. A, B, and C - Answer Inner ear. Although the exact cause of Meniere's Disease remains a mystery, which of the following could most reasonably be caused by a build up of excessive endolymph fluid? A. Auditory canal becomes blocked B. Hair cell function is altered C. Stapes can no longer vibrate D. Tympanic me...

GAS EXCHANGE - Answer One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2 . Where does the CO2 come from? - Answer CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration The lungs are highly branched. What is the primary purpose of this branching? - Answer It increases the surface area of the lungs -The alveoli account for volume How do gases "know" which way to flow? - Answer Gas flo...

Shown below is the start of a coding region within the first exon of a gene. Which sequence could you use for your sgRNA? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 3' CGACACAGCATGTCAAGAGA 5' (b) 5' CGACACAGCATGTCAAGAGA 3' (c) 3' GCTGTGTCGTACAGTTCTCT 5' (d) 5' GCTGTGTCGTACAGTTCTCT 3' - Answer (c) 3' GCTGTGTCGTACAGTTCTCT 5' Shown below is the sta...

What does complex multicellularity require? - Answer Cohesion among cells Communication among cells How do cells communicate? - Answer Through molecular signals What are gap junctions? - Answer (communicating junctions) provide cytoplasmic channels between adjacent cells What are the two things that influence cell activity? - Answer physical environment and neighboring cells/nearby/distant What are the 4 things that contribute to communication by chemical signals...

1 Exam (elaborations) MIMG 101 - Chap 3 & 5 Questions and Correct Answers. 2 Exam (elaborations) MIMG 101 Practice Exam and All Actual Answers 2026 Updated. 3 Exam (elaborations) MIMG 101 MIDTERM STUDY GUIDE EXAM AND ACTUAL ANSWERS 2026-2027 UPDATED.

Gram +ve key characteristics - Answer thick peptidoglycan no outer membrane teichoic acids stain purple smaller periplasmic space = peptidoglycan + plasma membrane monoderm Gram -ve key characteristics - Answer thin peptidoglycan layer outer membrane LPS --> Lipid, lipoproteins, lipopolysaccharides stain pink or red larger periplasmic space no teichoic acids movement in outer mem is restricted --> transport by porins Braun's lipoprotein diderm prokaryot...

Essential Nutrients - Answer those compounds a microbe cannot make itself but must gather from its environment if the cells is to grow and divide Macro Nutrients - Answer nutrients needed in large quantities ex: carbon, nitrogen, phosphorus, hydrogen, oxygen, and sulfur for carbohydrates. Lipids, nucleic acids, and proteins for the cell. cofactors - Answer fit into specific enzymes and aid in teh catalytic process like Mg2+, Fe2+, K+. Can also be regulatory signal molecules ...

robert hooke - Answer first description of microorganisms leeuwenhoek - Answer first person to see bacteria louis pasteur - Answer did not believe in spontaneous generation, heat experiment and seal experiment, organisms still grow robert koch - Answer linked cause and effect in an infectious disease Koch's Postulates - Answer 1. The suspected pathogen must be present in all cases of the disease and absent from healthy animals. 2. The suspected pathogen m...

how does the Trp repressor work? what is it called when trp is around and not around? - Answer No trp: it is an aporepressor- it does not bind to operon and transcription occurs Yes trp: it is a holorepressor- trp binds to repressor and turns it into a holorepressor. the holorepressor binds to operon and supresses transcription. NOTE! the holorepressor is a leaky repressor, some transcription continues to occur- this is why there are more means to control expression what is transcriptio...

Know the types of equal and unequal cell division - Answer Equal: binary fission Unequal: budding Budding division - Answer - a new cell emerges and buds off from a mother cell (daughter cell is genetically identical but different in size/function from mother cell) - some budding bacteria have cytoplasmic extensions - in multiple fission, one hyphae has multiple locations of new cell growth along its length Describe the steps of binary fission (bacterial DNA replication, molec...

What are the 2 main differences between unicellular and multicellular developmental programs? - Answer - Differentiation: Cells in unicellular end up as the same cells; in multicellular they differentiate for different functions - Decision making: Unicellular doesn't coordinate with others (senses only for itself), Multicellular does coordinate with others (cells signal to each other). What type of bacteria are streptomycetes and why are they of interested to study? - Answer gra...

Epidemiology - Answer -the study of the occurrence, distribution, and determinants of health and disease in population (public health, analyzing public health, not treatment of disease) ◦ A major job is to carry out disease surveillance (observations, reporting of disease) Epidemiologists - Answer -carry out disease surveillance (observation, recognition, and reporting of diseases as they occur), use data to formulate effective public health measures for disease control, prevent ...

sigma factor - Answer 1. Confers tight binding to the promoter 2. Without this, the holoenzyme is only a "core" promotor, filter-binding assay - Answer Experiments to determine that *sigma factor* allows for tight binding to the ________________: 1. Experiment where core vs. holoenzyme was allowed to bind to radiolabelled DNA, and measured rate at which each jumped onto nonradioactive DNA 2. Core jumped off radioactive DNA at a much higher rate 3. Doing a ________________...

Epidemiology - Answer -the study of the occurrence, distribution, and determinants of health and disease in population (public health, analyzing public health, not treatment of disease) ◦ A major job is to carry out disease surveillance (observations, reporting of disease) Epidemiologists - Answer -carry out disease surveillance (observation, recognition, and reporting of diseases as they occur), use data to formulate effective public health measures for disease control, prevent ...

Hydrogenosomes - Answer anaerobic endosymbiont that makes ATP via fermentation working distance - Answer distance between objective lens and specimen Fluorochromes - Answer absorb light and emit visible fluorescent light; labeled probes used to localize specific proteins gram negative - Answer the group of bacteria that have a structurally complex cell wall and contain less peptidoglycan; often more toxic; can be rinsed of color by alcohol gram positive - Answer ...

robert hooke - Answer first description of microorganisms leeuwenhoek - Answer first person to see bacteria louis pasteur - Answer did not believe in spontaneous generation, heat experiment and seal experiment, organisms still grow robert koch - Answer linked cause and effect in an infectious disease Koch's Postulates - Answer 1. The suspected pathogen must be present in all cases of the disease and absent from healthy animals. 2. The suspected pathogen m...

Explain parts of a lac operon - Answer control locus: encodes proteins that bind repressor and rna polymerase repressor: acts as on and off switch, codes for repressor protein structural locus: genes turned on and off by the operon Example of inducible and repressible operon - Answer repressible: arginine operon (regulates arginine amino acid synthesis), arginine represses operon by neg feedback inducible: lac operon (regulates breakdown of lactose), repressed aka induced by lact...

Summarize Griffith's experiments on transformation - Answer Griffith's experiments allowed him to observe the change of nonvirulent organisms into virulent ones. This means that living bacteria could transfer some component to dead bacteria. - to do this, he injected mice with a live smooth strain of Streptococcus pneumoniae, which killed them - he then injected them with a live rough strain of the same bacteria, which did not harm the mouse - then, he injected mice with a heat-kil...

Antoni van Leewenhoek - Answer • Dutch amateur microscope builder • Observed "animalcules" (microscopic animals) Lazzaro Spallanzani - Answer • Experiment to test where microbes come from: "spontaneous generation" (life arose from inanimate chemicals) or "life from life" (microbes are already present in air) • experiment: heated a test tube then added stopper -> found that there was no growth -> supported spontaneous generation • criticisms: o ...