COCO SOLUTIONS ACADEMIC STORE

Primary Components of a Health Assessment - Answer -History (Subjective Data) -Physical Exam (Objective Data) -Data Documentation Subjective vs. Objective Data - Answer -subjective (symptoms) = reported by the patient, family members, etc. -objective (signs) = directly observed by the provider Types of Health Assessments - Answer -Comprehensive -Problem-Based / Focused -Episodic -Screening Components of a Comprehensive Health History - Answer -Identifying Infor...

1 Exam (elaborations) NSG 302 - Exam 1 Questions and All Correct Answers 2026 Updated. 2 Exam (elaborations) NSG 302: Final Exam Questions with Guaranteed Pass Solutions 2026 Updated. 3 Exam (elaborations) NSG 302 Final Exam Questions with Guaranteed Pass Solutions 2026 Updated.

Select all factors that may influence a person's hygiene practices SELECT ALL THAT APPLY - Personal preferences - Health - Culture - Religion - Energy level - Answer Personal preferences Health Culture Religion Energy Level Which scheduled hygiene care is usally thought of as including a back massage to help the patient relax? - Early morning care - Hour of sleep care - As needed (PRN) care - Morning care - Answer hour of sleep care The nurse is teaching nursing ...

Acute Kidney Injury (AKI) - Answer sudden, rapid loss of renal function due to damage to the kidneys; formerly called acute renal failure AKI category- Prerenal (before kidneys) - Answer Decrease blood flow to the kidneys (hypoperfusion) Hypovolemia -Severe dehydration -Heart failure (decreased cardiac output). -Burns (volume depletion and dehydration. With no skin, no fluids). -Hemorrhage -Severe diarrhea and extreme vomiting (hyperemesis) -Septic shock/ hypotension Vasocon...

a patient has a serum calcium total level of 13.4 mg/dL, which disorder would the nurse suspect? a. hyperphosphatemia b. hyperparathyroidism c. magnesium deficiency d. type 2 diabetes - Answer B-hyperparathyroidism a patient with thyroid nodules is to undergo a thyroid scan with oral radioactive isotopes which instructions if given by the nurse are appropriate? a. "the test cannot be complete if you have an allergy to iodine or shellfish" b. "it is important to drink at l...

A physician tells the nurse that a patient's vertebra prominens is tender and asks the nurse to reevaluate the area in 1 hour. The area of the body the nurse will assess is the area: - Answer at the level of the C7 vertebra A mother brings her 2-month-old daughter in for an examination and says, My daughter rolled over against the wall, and now I have noticed that she has this spot that is soft on the top of her head. Is something terribly wrong? The nurses best response would be: - A...

in primary hypothyroidism TSH is ___ and T3/T4 is ___ - Answer increased, low in secondary hypothyroidism TSH is ___ and T3/T4 is ___ - Answer decreased, low in primary hyperthyroidism TSH is ___ and T3/T4 is ___ - Answer decreased, high signs and symptoms associated with hyperthyroidism - Answer anxiety, diaphoresis, fatigue, emotional lability, fine tremors, increased appetite, weight loss, smooth warm skin, fine thin hair, exophthalmos, tachycardia, heat intolera...

Which organisms contain bacteriochlorophyll? - Answer purple sulfur, purple non-sulfur, and green sulfur bacteria The biochemical reaction, PEP + ADP → Pyruvate + ATP, is an example of which of these? - Answer Substrate-level phosphorylation Where is the reaction center of photosystems located? - Answer Within a biological membrane. What is denitrification? - Answer The reduction of nitrate to dinitrogen What are the NET products of the Embden-Meyerhof pathway, ...

c and a - Answer In lab, a dialysis tube is filled with a 15% sucrose solution, sealed, and placed in an unlabeled beaker filled with clear liquid. The dialysis tube is made of a semipermeable membrane that allows the free passage of water, but is not permeable to sucrose. After 2 hours, the bag in the beaker decreases in size and becomes flaccid. This observation suggests that at the beginning of the experiment, the solution in the bag was __________________ compared to the solution in the...

Cellular comm consists of 4 essential parts - Answer -signaling cell -signaling molecule -receptor protein -responding cell signaling cell - Answer The source of the signaling molecule signaling molecule - Answer -carries info from 1 cell to the next -binds to a receptor protein on/in the responding cell -vary immensely and include peptides, lipids, and gases responding cell - Answer The cell that receives info from the signaling molecule steps in cell signal...

A drug selectively blocks Ca2+ channels at the axon terminus. The membrane potential at the terminus will: - Answer not change If you are able to change the resting membrane potential of a neuron from -70 to -80 mV, firing an action potential in that neuron would be: - Answer harder A mutation on the voltage gated potassium channels that renders them non-function will ___ the time an action potential normally takes to complete. - Answer increase The membrane permeability ...

Discuss how a signal can lead to both short- and long-term responses - Answer Signaling cell —> signaling molecule —> receptor protein —> responding Signal binds and receptor is activated (conformational change) Signal transduction— one molecule activates the next Response— enzyme activation, turn on genes, signal other cells, cause transcription of proteins Receptor Kinase activity because changes gene expression=> long-term G-Protein-coupled rec...

what happens when sound vibrations hit the tympanic membrane (eardrum)? - Answer tympanic membrane vibrates, causes stapes to push oval window, oval window vibration pushes fluid through cochlea what happens once sound vibrations reach the cochlea? - Answer push basilar membrane up, hair cells bend and depolarize, push tectorial membrane >> triggers neurotransmitter release what do hair cell stereocilia bend against? - Answer the tectorial membrane what happens to h...

microbiota - Answer refers to the organisms themselves ( includes bacteria, viruses, archaea, fungi, and protozoa) microbiome - Answer entire habitat including microorganisms, their genomes, and their surroundings conditions metagenome - Answer collection of genes and genomes from microbiota holobiont - Answer entire host and its microbe symbionts symbiont - Answer different organisms that live together mutualist - Answer host and microbes benefit ...

Meniere's Disease is linked to an excessive volume of endolymph fluid. Where in the ear is endolymph found? A. Outer ear B. Middle ear C. Inner ear D. B and C E. A, B, and C - Answer Inner ear. Although the exact cause of Meniere's Disease remains a mystery, which of the following could most reasonably be caused by a build up of excessive endolymph fluid? A. Auditory canal becomes blocked B. Hair cell function is altered C. Stapes can no longer vibrate D. Tympanic me...

GAS EXCHANGE - Answer One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2 . Where does the CO2 come from? - Answer CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration The lungs are highly branched. What is the primary purpose of this branching? - Answer It increases the surface area of the lungs -The alveoli account for volume How do gases "know" which way to flow? - Answer Gas flo...

Shown below is the start of a coding region within the first exon of a gene. Which sequence could you use for your sgRNA? 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' (a) 3' CGACACAGCATGTCAAGAGA 5' (b) 5' CGACACAGCATGTCAAGAGA 3' (c) 3' GCTGTGTCGTACAGTTCTCT 5' (d) 5' GCTGTGTCGTACAGTTCTCT 3' - Answer (c) 3' GCTGTGTCGTACAGTTCTCT 5' Shown below is the sta...

What does complex multicellularity require? - Answer Cohesion among cells Communication among cells How do cells communicate? - Answer Through molecular signals What are gap junctions? - Answer (communicating junctions) provide cytoplasmic channels between adjacent cells What are the two things that influence cell activity? - Answer physical environment and neighboring cells/nearby/distant What are the 4 things that contribute to communication by chemical signals...

1 Exam (elaborations) MIMG 101 - Chap 3 & 5 Questions and Correct Answers. 2 Exam (elaborations) MIMG 101 Practice Exam and All Actual Answers 2026 Updated. 3 Exam (elaborations) MIMG 101 MIDTERM STUDY GUIDE EXAM AND ACTUAL ANSWERS 2026-2027 UPDATED.

Gram +ve key characteristics - Answer thick peptidoglycan no outer membrane teichoic acids stain purple smaller periplasmic space = peptidoglycan + plasma membrane monoderm Gram -ve key characteristics - Answer thin peptidoglycan layer outer membrane LPS --> Lipid, lipoproteins, lipopolysaccharides stain pink or red larger periplasmic space no teichoic acids movement in outer mem is restricted --> transport by porins Braun's lipoprotein diderm prokaryot...