- Study guides, Class notes & Summaries

MB ASCP Ch 13 Molecular Detection of Inherited Diseases Estimatics En polymorphisms -ANSWER mutations useful for mapping, determining parentage balanced polymorphisms -ANSWER just a DNA sequence difference, the phenotypic effect of which is counteracted by a second trait or polymorphism methylation -ANSWER usually cytosine in CpG islands, shuts down RNA transcription by adding methyl groups genomic impringing -ANSWER enzymatic addition of methyl groups to specific nitrogen bases in a pr...

-

5 pages

Written in 2022/2023

AMINAHASSAN001

Certification Exam Cards(complete solution graded).When handling blood spots, one should A. be even more careful when handling blood than other body fluids. B. protect from cross contamination from other blood spots C. store at room temperature up to 24 hours D. store at 4 degrees C for up to 7 years - ANSWERB. protect from cross contamination from other blood spots In handling blood serum, one should A. store in eppendorf tube in refrigerator indefinitely B. separate from ce...

-

43 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

ASCP BOC EXAM Study GuideWhen using an electronic cell counter, which of the following results can occur in the presence of a cold agglutination? a) increased MCV and decreased RBC b) increased MCV and normal RBC c) decreased MCV and increased MCHC d) decreased MCV and RBC - ANSWERa) increased MCV and decreased RBC Cerebrospinal fluid for glucose assay should be: a) refrigerated b) analyzed immediately c) heated to 56 degree C d) stored at room temp after centrifugation - ANSWERb) analyzed im...

-

11 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Molecular Diagnostics Chapter 4(Well Solved). gel electrophoresis -ANSWERS. Procedure used to separate and analyze DNA fragments by placing a mixture of DNA fragments at one end of a porous gel and applying an electrical voltage to the gel Is the anode positive or negative? What about the cathode? -ANSWERS. Positive, negative DNA/RNA are positively/negatively charged? They migrate towards anode or cathode? -ANSWERS. negatively, anode Do large or small size DNA fragments migrate faster?...

-

4 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Molecular Diagnostics Chapter 11 ORIGINAL VERSION. What are examples of PCR inhibitors? - ANSWERS.hemoglobin, acidic polysacharrides, nitrate, crystals, beta-human chorionic gonadatropin, heparin, lactoferrin, anticoagulants, sodium polyanethol sulfonate, and polyamines STAR - ANSWERS.stool transport and recovery buffer inactivates infectious organisms What is the purpose of a sensitivity control? - ANSWERS.shows lower limit of detection true negative - ANSWERS.Indicates accurately tha...

-

5 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Molecular Diagnostics Chapter 7(All Correct Answers Avaible)chromosome mutation - ANSWERS.change in chromosome structure Genome mutations - ANSWERS.changes in chromosome number Euploid - ANSWERS.an individual with How many base pairs are in the human genome? - ANSWERS.2.9 billion What is the difference between a mutation and a polymorphism? - ANSWERS.mutations are reserved for rare changes in DNA like those found in cancer. Polymorphisms are variants that occur in 1-2% of the population...

-

5 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Translocations Advanced 2023.t(1,13) - ANSWERPAX3/7 + FKHR (there are two of these) Rhabdomyosarcoma t(2:13) - ANSWERPAX3/7 + FKHR (there are two of these) Rhabdomyosarcoma t(11:22) - ANSWEREwing sarcoma, childhood neoplasms, EWSR1 t(x:18) - ANSWERsynovial sarcoma, SS18, reciprocal translocation ss18/syt—>ssx1/ssx2 t(9:22) - ANSWERPhiladelphia chromosome, CML (BCR-ABL activation, tyrosine kinase oncogene) t(15:17) - ANSWERacute promyelocytic leukemia PML/RARA t(8:14) ...

-

1 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Molecular Diagnostics Chapter 5(revised edition).What type of restriction enzyme is commonly used in the laboratory? - ANSWERtype II, 4-6 bp recognition sites restriction map - ANSWERdiagram that shows the lengths of fragments between restriction sites in the strand of DNA If you cut a linear fragment of DNA with a restriction enzyme at three sites, how many fragments do you have? What about if you cut a plasmid at three sites - ANSWER4 fragments, 3 fragments How do you perform restrict...

-

7 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Molecular Diagnostics Chapter 13 Assessment.Oncogenes genes that cause cancer by blocking the normal controls on cell reproduction, oncogenes prevent apoptosis

-

6 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Practice test questions for MBASCP updated version.Mutation in this gene (Xp21) is associated with Duchenne Muscular Dystrophy: a. Dystrophin b. P53 c. Musculin d. C-myc - a. Dystrophin This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I - Type III What links codons and anti-codons together during DNA translation? DNA ligase Single-stranded binding protein Complementary base pairing GTP - Complementary base pairing ...

-

29 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB ASCP Chapter 1 Study Questions and Answers.What is the function of DNA in the cell - aANSWERCarry genetic information How do purines and pyrimidines - aANSWERPurines have double ring; pyrimidines have a single ring Write the complementary sequence for the following DNA sequence 5' AGGTCACGTCTAGCTAGCTAGA 3' - aANSWER5' AGGTCACGTCTAGCTAGCTAGA 3' Answer: 5' TCTAGCTAGCTAGACGTGACCT 3' Which of the ribose carbons participate in the phosphodiester bond - aANSWERThe 5' ribose carbon...

-

3 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB (ASCP) 2021 - Translocations, Diseases, Pharma, Polymerases, & more 2023.Chronic Myeloid Leukemia (CML) - ANSWERt(9;22) BCR-ABL translocation Ewing sarcoma - ANSWERt(11;22) EWS-FLI1 Acute Lymphocytic Leukemia (ALL) - ANSWERt(9;22) BCR-ABL p190 protein Follicular Lymphoma - ANSWERt(14;18) BCL2 translocation Mantle Cell Lymphoma - ANSWERt(11;14) bcl-1 translocation CCND1-IgH Burkitt Lymphoma - ANSWERt(8;14) MYC gene translocation Rhabdomyosarcoma (alveolar); Cancer/soli...

-

10 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

Chapter 1 MB Buckingham ASCP New Version. Johann Friedrich Miescher - ANSWERDiscovered DNA 1869. Extracted a viscous substance from isolated white blood cells. Prepared nuclei of cells by adding pepsin. Chemical analysis of this substance found in nuclei ("nuclein") showed that it was 14% N and 2.5% P, different from other known biochemicals. Nucleotides - ANSWERBuilding blocks of DNA, 700 kilodaltons each. Consists of a 5 C sugar where the 1st C is covalently bonded to a N base,...

-

2 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

ASCP MB Certification Study, Buckingham Ch. 13 Solution Packcongenital - ANSWER"born with"; having a genetic component Lyon hypothesis - ANSWERhypothesis stating that only one X-chromosome remains active in females. Barr body - ANSWERX chromatin; a structure visible in the interphase nucleus, formed by the inactive X chromasome autosomes - ANSWERnon-sex chromosomes; any chromosome except for the X and Y sex chromosomes polyploidy - ANSWERin diploid organisms, having more than two o...

-

6 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB ASCP Test Molecular Techniques (20-30%) 100% Correct Answers. What are the 3 types of gel electrophoresis -ANSWER Agarose Polyacrylamide Pulse Field What is gel electrophoresis -ANSWER the separation of materials based on size and migration patterns when subjected to electrical forces in a resistive medium. which direction does the DNA flow in gel electrophoresis -ANSWER due to DNA being negatively charged, it will migrate towards the positive end What determines how far the DNA w...

-

12 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB ASCP Demo Practice Exam Questions1. Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? A. 5'-ATCTATGTCGGCAATT-3' B. 5'-TTAACGGCTGTATCTA-3' C. 5'-AATTGCCGACATAGAT-3' D. 5'-GAGCACGCTATCTTAT-3' - ANSWERA. 5'-ATCTATGTCGGCAATT-3' 2. Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? A. 60°C B. 58°C C. 64°C D. 62°C - ANSWERB. 58°C ...

-

2 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB ASCP CONNECT(edited version).What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) ANSWER- t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% AN...

-

38 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001

MB ASCP Study Aids Buckingham Ch. 7 2023 Updated.Polymerase Chain Reaction (PCR) - ANSWERPrimer-directed DNA polymerization in vitro resulting in amplification of specific DNA sequences. Target amplification - ANSWERTarget: Specific sequences or regions that are detected in an analytical procedure. Amplification: Replication/copying Target amplification: replication of a specific target region of DNA. Template - ANSWERSingle stranded nucleic acid used as a guide for replication or synthesi...

-

5 pages

Written in 2022/2023

Grade A+

AMINAHASSAN001