- Study guides, Class notes & Summaries
Looking for the best study guides, study notes and summaries about ? On this page you'll find 10 study documents about .
10 results
-
Exam (elaborations)
LS7A: Final Exam Questions with Complete Solutions Graded A+
-
---57June 20262025/2026A+
- c and a - Answer In lab, a dialysis tube is filled with a 15% sucrose solution, sealed, and placed in an unlabeled beaker filled with clear liquid. The dialysis tube is made of a semipermeable membrane that allows the free passage of water, but is not permeable to sucrose. After 2 hours, the bag in the beaker decreases in size and becomes flaccid. This observation suggests that at the beginning of the experiment, the solution in the bag was __________________ compared to the solution in the...
-
$13.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LS7C: Final UCLA Latest Exam with Guaranteed Pass Solutions 2026-2027 Updated.
-
---7June 20262025/2026A+
- Cellular comm consists of 4 essential parts - Answer -signaling cell 
-signaling molecule 
-receptor protein 
-responding cell 
 
signaling cell - Answer The source of the signaling molecule 
 
signaling molecule - Answer -carries info from 1 cell to the next 
-binds to a receptor protein on/in the responding cell 
-vary immensely and include peptides, lipids, and gases 
 
responding cell - Answer The cell that receives info from the signaling molecule 
 
steps in cell signal...
-
$13.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LS 7C: Midterm 1 Test Questions Solved Correct.
-
---4June 20262025/2026A+
- A drug selectively blocks Ca2+ channels at the axon terminus. The membrane potential at the terminus will: - Answer not change 
 
If you are able to change the resting membrane potential of a neuron from -70 to -80 mV, firing an action potential in that neuron would be: - Answer harder 
 
A mutation on the voltage gated potassium channels that renders them non-function will ___ the time an action potential normally takes to complete. - Answer increase 
 
The membrane permeability ...
-
$11.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LS 7C: Midterm 1 Learning Objectives Test Questions and All Correct Answers 2026Updated.
-
---20June 20262025/2026A+
- Discuss how a signal can lead to both short- and long-term responses - Answer Signaling cell —> signaling molecule —> receptor protein —> responding 
 Signal binds and receptor is activated 
 (conformational change) 
 Signal transduction— one molecule activates 
 the next 
 Response— enzyme activation, turn on genes, 
 signal other cells, cause transcription of 
 proteins 
 
Receptor Kinase activity because changes gene expression=> long-term 
G-Protein-coupled rec...
-
$13.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LS 7C MIDTERM 2 Study Guide Exam and All Correct Answers 2026 Updated. 
 

-
---15June 20262025/2026A+
- what happens when sound vibrations hit the tympanic membrane (eardrum)? - Answer tympanic membrane vibrates, causes stapes to push oval window, oval window vibration pushes fluid through cochlea 
 
what happens once sound vibrations reach the cochlea? - Answer push basilar membrane up, hair cells bend and depolarize, push tectorial membrane >> triggers neurotransmitter release 
 
what do hair cell stereocilia bend against? - Answer the tectorial membrane 
 
what happens to h...
-
$13.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LS 7C Final Exam Questions and Answers. 
 

-
---5June 20262025/2026A+
- microbiota - Answer refers to the organisms themselves ( includes bacteria, viruses, archaea, fungi, and protozoa) 
 
microbiome - Answer entire habitat including microorganisms, their genomes, and their surroundings conditions 
 
metagenome - Answer collection of genes and genomes from microbiota 
 
holobiont - Answer entire host and its microbe symbionts 
 
symbiont - Answer different organisms that live together 
 
mutualist - Answer host and microbes benefit 
 
...
-
$12.49 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LifeSci 7C: Midterm 2 Clickers Test Questions and Answers.
-
---6June 20262025/2026A+
- Meniere's Disease is linked to an excessive volume of endolymph fluid. Where in the ear is endolymph found? 
A. Outer ear 
B. Middle ear 
 C. Inner ear 
D. B and C 
E. A, B, and C - Answer Inner ear. 
 
Although the exact cause of Meniere's Disease remains a mystery, which of the following could most reasonably be caused by a build up of excessive endolymph fluid? 
A. Auditory canal becomes blocked 
 B. Hair cell function is altered 
 C. Stapes can no longer vibrate 
 D. Tympanic me...
-
$11.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
LifeSci 7C - Physiology - Final Exam Questions and All Correct Answers 2026 Updated.
-
---17June 20262025/2026A+
- GAS EXCHANGE - Answer 
 
One of the functions of the cardiovascular 
and respiratory systems is to rid the body 
of CO2 
. Where does the CO2 
come from? - Answer CO2 
is a breakdown product of the carbohydrates 
oxidized in cellular respiration 
 
The lungs are highly branched. What is 
the primary purpose of this branching? - Answer It increases the surface 
area of the lungs 
-The alveoli account for volume 
 
How do gases "know" 
which way to flow? - Answer Gas flo...
-
$13.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
Life Science: W10 PEQs Test Questions and All Correct Answers.
-
---4June 20262025/2026A+
- Shown below is the start of a coding region within the first exon of a gene. Which sequence could you use for your sgRNA? 
 
5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 
3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' 
 
(a) 3' CGACACAGCATGTCAAGAGA 5' 
(b) 5' CGACACAGCATGTCAAGAGA 3' 
(c) 3' GCTGTGTCGTACAGTTCTCT 5' 
(d) 5' GCTGTGTCGTACAGTTCTCT 3' - Answer (c) 3' GCTGTGTCGTACAGTTCTCT 5' 
 
Shown below is the sta...
-
$11.99 More Info
COCOSOLUTIONS
-
Exam (elaborations)
Life Science 7C: Fall 2023 Midterm – UCLA Test Questions Fully Solved.
-
---17June 20262025/2026A+
- What does complex multicellularity require? - Answer Cohesion among cells 
Communication among cells 
 
How do cells communicate? - Answer Through molecular signals 
 
What are gap junctions? - Answer (communicating junctions) provide cytoplasmic channels between adjacent cells 
 
What are the two things that influence cell activity? - Answer physical environment and neighboring cells/nearby/distant 
 
What are the 4 things that contribute to communication by chemical signals...
-
$13.99 More Info
COCOSOLUTIONS