BIO 107 LECTURE FINAL EXAM
The bonds connecting adjacent nucleotides in a nucleic acid - Correct Answers -
Phosphdiester bonds
The bonds connecting adjacent amino acids in a protein - Correct Answers -Peptide
bonds
The bonds holding paired bases together in opposing strands of DNA - Correct Answers
-Hydrogen bonds
The bonds stabilizing secondary structures in proteins - Correct Answers -hydrogen
bonds
The covalent bonds linking distant cysteine amino acid residues in protein tertiary
structures - Correct Answers -Disulfide bridges
Gene expression is mostly regulated through control of gene transcription. - Correct
Answers -True
If the relative amounts of the four different bases in the DNA of a cell were measured,
and 20% of the bases were Guanine, what percentage of bases would you expect to be
Thymine? (Chargaff's rule) - Correct Answers -30%
Sequence of complementary strand of DNA - 5' ATAACCG 3' - Correct Answers -
5'CGGTTAT 3'
Mark all of the levels of structure you would expect to find in a double-stranded DNA
molecule. - Correct Answers -Primary structure (sequence) + Secondary structure
What features would you expect to find in double-stranded DNA - Correct Answers -
Helical structure, anti-parallel strands, A-T, G-C, negative charge
Which of the following statements is accurate about the relationship between specific
transcription factors and control elements. - Correct Answers -Activators bind to
enhancers and Repressors bind to Silencers.
Which of the following are forms or RNA processing. (Three of these are correct) -
Correct Answers -3' Poly-A tail, Splicing, 5' Cap
,Prokaryotes do not process mRNA, translation occurs almost simultaneously as the
mRNA is being transcribed. - Correct Answers -True
What are the two features of Nucleic Acids that make them useful for storing
information? - Correct Answers -Directionality (5' to 3') and Individuality (4 different
bases in many possible combinations)
This molecule is the building block of which macromolecule in cells - Correct Answers -
DNA
Mark all of the levels of structure you would expect to find in a protein that functions as
a complex with multiple polypeptide subunits. - Correct Answers -Primary, Secondary,
Tertiary, Quaternary
What is this structure (Amino Group, Side Chain, Carboxyl Group) - Correct Answers -
Amino Acid
Initiation - Correct Answers -The RNA Polymerase is recruited to the front of a gene by
transcription factors at the promoter.
Elongation - Correct Answers -The RNA polymerase adds ribonucleotides at the 3' end
of the RNA based on the DNA sequence of the template strand
Termination - Correct Answers -The RNA polymerase leaves the DNA after interaction
with a terminating sequence/protein
Transcription factors are peptides that bind to the promoter in RNA. - Correct Answers -
False
5'- TAGTC TACAG GGTAC ATCCT -3' - what's the mRNA sequence - Correct Answers
-5'- UAGUCUACAGGGUACAUCCU
What kind of molecule is this? (H2N, COOH) - Correct Answers -polypetide
Which of the following are characteristics of ALL amino acids (There are four (4) good
answers in this list): - Correct Answers -An R-group attached to the Alpha carbon
An Alpha carbon at the center
A carboxyl group
an amine group
DNA - Correct Answers -Deoxyribonucleotides
mRNA - Correct Answers -Ribonucleotides
protein (polypeptide) - Correct Answers -Amino Acids
, rRNA - Correct Answers -Ribonucleotides
Which of these descriptions best represents the progression of tumorigenesis (the
transition of normal cells to tumor cells)? - Correct Answers -A lineage of cells in which
mutations accumulate over time, each providing cells derrived from that cell a selective
growth advantage.
Which type of mutation would NOT be associated a cell becoming cancerous? - Correct
Answers -A deletion that eliminated a gene essential for cell survival
The proteins expressed by a cell determine the jobs it can do and the role that cell plays
in a multi-cellular organism. Where does the cell store the information for all of its
proteins? - Correct Answers -DNA
Using Chargaff's rules, if the percent of G in a bacterial species is approximately 30%,
then the percent of T is: - Correct Answers -20%
Which best describes what "Chromatin" is in the cell? - Correct Answers -The DNA and
DNA-associated proteins
Choose the DNA sequence that would complement (base pair with) the following DNA
sequence.
5' - C A G G A C T - 3' - Correct Answers -5' AGTCCTG
Transcription - Correct Answers -RNA Polymerase
RNA Processing - Correct Answers -Spliceosome
Translation - Correct Answers -Ribosome
DNA Replication - Correct Answers -DNA Polymerase
DNA is the transforming substance in bacteria - Correct Answers -Avery's Experiment
There is a transforming substance that lets some bacteria get information from other
bacteria - Correct Answers -Griffith's Experiment
Bacteriophage DNA is what is transferred to host bacteria during infection - Correct
Answers -Hersy Chase Experiment
Which of the following terms describes a type of processing done to pre-mRNA to make
mature mRNA in eukaryotic cells? (Choose 3) - Correct Answers -Poly-Adenosine tail,
Splicing, 5' Cap
Which of the following would be found at or near the 3' end of a processed eukaryotic
mRNA? - Correct Answers -Poly-A tail
The bonds connecting adjacent nucleotides in a nucleic acid - Correct Answers -
Phosphdiester bonds
The bonds connecting adjacent amino acids in a protein - Correct Answers -Peptide
bonds
The bonds holding paired bases together in opposing strands of DNA - Correct Answers
-Hydrogen bonds
The bonds stabilizing secondary structures in proteins - Correct Answers -hydrogen
bonds
The covalent bonds linking distant cysteine amino acid residues in protein tertiary
structures - Correct Answers -Disulfide bridges
Gene expression is mostly regulated through control of gene transcription. - Correct
Answers -True
If the relative amounts of the four different bases in the DNA of a cell were measured,
and 20% of the bases were Guanine, what percentage of bases would you expect to be
Thymine? (Chargaff's rule) - Correct Answers -30%
Sequence of complementary strand of DNA - 5' ATAACCG 3' - Correct Answers -
5'CGGTTAT 3'
Mark all of the levels of structure you would expect to find in a double-stranded DNA
molecule. - Correct Answers -Primary structure (sequence) + Secondary structure
What features would you expect to find in double-stranded DNA - Correct Answers -
Helical structure, anti-parallel strands, A-T, G-C, negative charge
Which of the following statements is accurate about the relationship between specific
transcription factors and control elements. - Correct Answers -Activators bind to
enhancers and Repressors bind to Silencers.
Which of the following are forms or RNA processing. (Three of these are correct) -
Correct Answers -3' Poly-A tail, Splicing, 5' Cap
,Prokaryotes do not process mRNA, translation occurs almost simultaneously as the
mRNA is being transcribed. - Correct Answers -True
What are the two features of Nucleic Acids that make them useful for storing
information? - Correct Answers -Directionality (5' to 3') and Individuality (4 different
bases in many possible combinations)
This molecule is the building block of which macromolecule in cells - Correct Answers -
DNA
Mark all of the levels of structure you would expect to find in a protein that functions as
a complex with multiple polypeptide subunits. - Correct Answers -Primary, Secondary,
Tertiary, Quaternary
What is this structure (Amino Group, Side Chain, Carboxyl Group) - Correct Answers -
Amino Acid
Initiation - Correct Answers -The RNA Polymerase is recruited to the front of a gene by
transcription factors at the promoter.
Elongation - Correct Answers -The RNA polymerase adds ribonucleotides at the 3' end
of the RNA based on the DNA sequence of the template strand
Termination - Correct Answers -The RNA polymerase leaves the DNA after interaction
with a terminating sequence/protein
Transcription factors are peptides that bind to the promoter in RNA. - Correct Answers -
False
5'- TAGTC TACAG GGTAC ATCCT -3' - what's the mRNA sequence - Correct Answers
-5'- UAGUCUACAGGGUACAUCCU
What kind of molecule is this? (H2N, COOH) - Correct Answers -polypetide
Which of the following are characteristics of ALL amino acids (There are four (4) good
answers in this list): - Correct Answers -An R-group attached to the Alpha carbon
An Alpha carbon at the center
A carboxyl group
an amine group
DNA - Correct Answers -Deoxyribonucleotides
mRNA - Correct Answers -Ribonucleotides
protein (polypeptide) - Correct Answers -Amino Acids
, rRNA - Correct Answers -Ribonucleotides
Which of these descriptions best represents the progression of tumorigenesis (the
transition of normal cells to tumor cells)? - Correct Answers -A lineage of cells in which
mutations accumulate over time, each providing cells derrived from that cell a selective
growth advantage.
Which type of mutation would NOT be associated a cell becoming cancerous? - Correct
Answers -A deletion that eliminated a gene essential for cell survival
The proteins expressed by a cell determine the jobs it can do and the role that cell plays
in a multi-cellular organism. Where does the cell store the information for all of its
proteins? - Correct Answers -DNA
Using Chargaff's rules, if the percent of G in a bacterial species is approximately 30%,
then the percent of T is: - Correct Answers -20%
Which best describes what "Chromatin" is in the cell? - Correct Answers -The DNA and
DNA-associated proteins
Choose the DNA sequence that would complement (base pair with) the following DNA
sequence.
5' - C A G G A C T - 3' - Correct Answers -5' AGTCCTG
Transcription - Correct Answers -RNA Polymerase
RNA Processing - Correct Answers -Spliceosome
Translation - Correct Answers -Ribosome
DNA Replication - Correct Answers -DNA Polymerase
DNA is the transforming substance in bacteria - Correct Answers -Avery's Experiment
There is a transforming substance that lets some bacteria get information from other
bacteria - Correct Answers -Griffith's Experiment
Bacteriophage DNA is what is transferred to host bacteria during infection - Correct
Answers -Hersy Chase Experiment
Which of the following terms describes a type of processing done to pre-mRNA to make
mature mRNA in eukaryotic cells? (Choose 3) - Correct Answers -Poly-Adenosine tail,
Splicing, 5' Cap
Which of the following would be found at or near the 3' end of a processed eukaryotic
mRNA? - Correct Answers -Poly-A tail
