(MB) ASCP Practice Exam Questions with Answers Graded A+
Which of the following is not a component of a which of the following factors?
nucleotide? Net charge of the molecule
Phosphate group Size of the molecule
Anti-codon Shape of the molecule
Ribose sugar Nucleotide sequence of the molecule -
Nitrogen base - ANSWER -Anti-codon ANSWER -Nucleotide sequence of the
molecule
According to Chargaff's rule of base pairing,
adenine pairs with: - ANSWER -Thymine What are the phases in a qPCR Amplification
Plot?
Initiation, exponential, plateau
What genes would be screened in a breast Baseline, exponential, plateau
cancer panel? - ANSWER -HER2, ERBB2, Baseline, threshold, exponential, plateau
BRCA1 Baseline, initiation, threshold, exponential,
plateau - ANSWER -Initiation, exponential,
plateau
Next Generation Sequencing uses: -
ANSWER -Short sequence reads
Find the palindrome in this restriction enzyme
site: 5'-CTGCAG-3'?
Purines and pyrimidines differ from each other in
5'-GAC
that: - ANSWER -Purines have two rings;
3'-GAC
pyrimidines have one ring
3'-CTG
5'-GTC - ANSWER -3'-GAC
The purines are:
Cytosine and uracil
Adenine and thymine A patient with impaired judgment, personality
Thymine and cytosine changes, signs of abnormal body movements
and depression comes to the physician's office
Adenine and guanine - ANSWER -Adenine
for a follow-up visit. The physician suspects a
and guanine
single-gene disorder may be the cause of those
clinical manifestations. A blood specimen was
then sent to your clinical laboratory for mutation
What is the rate of mutation per round of DNA
screening in the Huntington gene. Testing with
replication?
standard PCR indicates that patient has
1 in 1,000 base pairs
Huntington Disease, HD. Which of the following
1 in 10,000 base pairs
would be consistent with this diagnosis?
1 in 1,000,000 base pairs
25 CAG repeats in the Huntington gene
1 in 1,000,000,000 base pairs - ANSWER - 85 CAG repeats in the Huntington gene
1 in 1,000,000,000 base pairs 25 CGA repeats in the Huntington gene
85 CGA repeats in the Huntington gene -
ANSWER -85 CAG repeats in the
The rate of DNA migration through an agarose
Huntington gene
gel during electrophoresis does not depend on
,(MB) ASCP Practice Exam Questions with Answers Graded A+
MAPK - ANSWER -BCR/Abl
Which two HPV types are responsible for most
cases of cervical cancer?
16 and 18 What is the rate of mammalian DNA replication?
31 and 59 500 nucleotides per second
16 and 58 100 nucleotides per second
44 and 59 - ANSWER -16 and 18 50 nucleotides per second
10 nucleotides per second - ANSWER -50
nucleotides per second
Replication forks, known as origins of DNA
replication, are created by this enzyme:
Ligase This polymerase is involved in "replicates
Taq Polymerase mitochondrial DNA": - ANSWER -Pol γ
Primase
Helicase - ANSWER -Helicase
A patient with impaired judgment, personality
changes, signs of abnormal body movements
Mutation in what gene is associated with Fragile and depression comes to the physician's office
X syndrome? - ANSWER -FMR1 for a follow-up visit. The physician suspects a
single-gene disorder may be the cause of those
clinical manifestations. A blood specimen was
Mantle cell lymphoma (MCL) is caused by what then sent to your clinical laboratory for mutation
translocation? - ANSWER -t(11;14) screening in the Huntingtin gene. Which of these
methods would best accomplish this task?
Methylation-specific PCR
This polymerase is involved in "initiation of DNA Standard PCR
replication and has primase activity": - PFGE
ANSWER -Pol α RAPD PCR - ANSWER -Standard PCR
Its discovery shed light on why there is Which of the following storage options is optimal
simultaneous, though not continuous, synthesis for storing isolated DNA for a period greater than
of DNA on both leading and lagging strands of seven years?
DNA: 22-25ºC
Klenow fragment of DNA polymerase 2-8ºC
Okazaki fragments -20ºC
Sanger fragments -70ºC - ANSWER --70ºC
RNA fragments - ANSWER -Okazaki
fragments
Consider a hypothetical mutation involving gene
X. Let's say you amplify a specific exon, say exon
What gene is measured following treatment with 11, of that gene then you cut it with restriction
imatinib (Gleevec)? enzyme W. In a person without the mutation,
FLT3 cutting the gene with restriction enzyme W
BCR/Abl generates two fragments of sizes, 100 bp and
Jak2 250 bp. Suppose a C>T mutation in gene X
, (MB) ASCP Practice Exam Questions with Answers Graded A+
deletes a restriction site, yielding a fragment of
350 bp. You would expect a heterozygous While at the doctor's office with your father, you
person for gene X to have these fragments on a overheard his physician tell another physician
restriction gel: that test results came in, confirming the presence
+/+ = 350 bp; 250 bp; 100 bp; of the Factor V Leiden mutation, a mutation
m/+ = Only the 350 bp associated with deep venous thrombosis. Which
m/+ = 350 bp; 250 bp; 100 bp of the following is the mutation your father has:
m/m = 350 bp; 250 bp - ANSWER -m/+ = A1691G
350 bp; 250 bp; 100 bp G1619A
1691G>A
C282Y - ANSWER -1691G>A
Which of the following will more likely lower
stringency conditions in the washing step of a
hybridization experiment? Consider the probe sequence,
Increase the concentration of salt in the wash CTACCGTAATATTCGACCGT, to be used in a
solution buffer hybridization procedure. What is the melting
Increase the temperature from, say 68°C to 75°C temperature, Tm, of the sequence?
Use a probe with a higher density of GC base 60°C
pairs as compared to one with a lower GC base 58°C
pair density 64°C
Remove formamide from the wash solution buffer 62°C - ANSWER -58°C
- ANSWER -Increase the concentration of
salt in the wash solution buffer
This polymerase acts on DNA and produces
Ribosomal RNA:
What enzyme is involved in LCR? -
ANSWER -DNA Ligase RNA Pol I
DNA Pol I
RNA Pol II
Next Generation Sequencing set-up require: DNA Pol II - ANSWER -RNA Pol I
Library preparation and extensive bioinformatics
analysis
BAC clones Sickle cell disease is an autosomal genetic
Use of translation factors disease due to a point mutation in the beta-globin
Hybridization - ANSWER -Library gene, where glutamic acid is substituted for
preparation and extensive bioinformatics analysis valine at the sixth codon of the gene, resulting in
a faulty hemoglobin S (Hb S). Sickle cell disease
is one of many genetic diseases where a single
Which of the subunits of RNA polymerase gene controls the expression of many phenotypic
holoenzyme is responsible for promoter traits. The phenomenon where a single gene
recognition? controls the expression of many phenotypic traits
Beta subunit is best referred to as: - ANSWER -
Sigma subunit Pleiotrophy
Gamma subunit
Delta subunit - ANSWER -Sigma subunit
What assay amplifies the target using a
Which of the following is not a component of a which of the following factors?
nucleotide? Net charge of the molecule
Phosphate group Size of the molecule
Anti-codon Shape of the molecule
Ribose sugar Nucleotide sequence of the molecule -
Nitrogen base - ANSWER -Anti-codon ANSWER -Nucleotide sequence of the
molecule
According to Chargaff's rule of base pairing,
adenine pairs with: - ANSWER -Thymine What are the phases in a qPCR Amplification
Plot?
Initiation, exponential, plateau
What genes would be screened in a breast Baseline, exponential, plateau
cancer panel? - ANSWER -HER2, ERBB2, Baseline, threshold, exponential, plateau
BRCA1 Baseline, initiation, threshold, exponential,
plateau - ANSWER -Initiation, exponential,
plateau
Next Generation Sequencing uses: -
ANSWER -Short sequence reads
Find the palindrome in this restriction enzyme
site: 5'-CTGCAG-3'?
Purines and pyrimidines differ from each other in
5'-GAC
that: - ANSWER -Purines have two rings;
3'-GAC
pyrimidines have one ring
3'-CTG
5'-GTC - ANSWER -3'-GAC
The purines are:
Cytosine and uracil
Adenine and thymine A patient with impaired judgment, personality
Thymine and cytosine changes, signs of abnormal body movements
and depression comes to the physician's office
Adenine and guanine - ANSWER -Adenine
for a follow-up visit. The physician suspects a
and guanine
single-gene disorder may be the cause of those
clinical manifestations. A blood specimen was
then sent to your clinical laboratory for mutation
What is the rate of mutation per round of DNA
screening in the Huntington gene. Testing with
replication?
standard PCR indicates that patient has
1 in 1,000 base pairs
Huntington Disease, HD. Which of the following
1 in 10,000 base pairs
would be consistent with this diagnosis?
1 in 1,000,000 base pairs
25 CAG repeats in the Huntington gene
1 in 1,000,000,000 base pairs - ANSWER - 85 CAG repeats in the Huntington gene
1 in 1,000,000,000 base pairs 25 CGA repeats in the Huntington gene
85 CGA repeats in the Huntington gene -
ANSWER -85 CAG repeats in the
The rate of DNA migration through an agarose
Huntington gene
gel during electrophoresis does not depend on
,(MB) ASCP Practice Exam Questions with Answers Graded A+
MAPK - ANSWER -BCR/Abl
Which two HPV types are responsible for most
cases of cervical cancer?
16 and 18 What is the rate of mammalian DNA replication?
31 and 59 500 nucleotides per second
16 and 58 100 nucleotides per second
44 and 59 - ANSWER -16 and 18 50 nucleotides per second
10 nucleotides per second - ANSWER -50
nucleotides per second
Replication forks, known as origins of DNA
replication, are created by this enzyme:
Ligase This polymerase is involved in "replicates
Taq Polymerase mitochondrial DNA": - ANSWER -Pol γ
Primase
Helicase - ANSWER -Helicase
A patient with impaired judgment, personality
changes, signs of abnormal body movements
Mutation in what gene is associated with Fragile and depression comes to the physician's office
X syndrome? - ANSWER -FMR1 for a follow-up visit. The physician suspects a
single-gene disorder may be the cause of those
clinical manifestations. A blood specimen was
Mantle cell lymphoma (MCL) is caused by what then sent to your clinical laboratory for mutation
translocation? - ANSWER -t(11;14) screening in the Huntingtin gene. Which of these
methods would best accomplish this task?
Methylation-specific PCR
This polymerase is involved in "initiation of DNA Standard PCR
replication and has primase activity": - PFGE
ANSWER -Pol α RAPD PCR - ANSWER -Standard PCR
Its discovery shed light on why there is Which of the following storage options is optimal
simultaneous, though not continuous, synthesis for storing isolated DNA for a period greater than
of DNA on both leading and lagging strands of seven years?
DNA: 22-25ºC
Klenow fragment of DNA polymerase 2-8ºC
Okazaki fragments -20ºC
Sanger fragments -70ºC - ANSWER --70ºC
RNA fragments - ANSWER -Okazaki
fragments
Consider a hypothetical mutation involving gene
X. Let's say you amplify a specific exon, say exon
What gene is measured following treatment with 11, of that gene then you cut it with restriction
imatinib (Gleevec)? enzyme W. In a person without the mutation,
FLT3 cutting the gene with restriction enzyme W
BCR/Abl generates two fragments of sizes, 100 bp and
Jak2 250 bp. Suppose a C>T mutation in gene X
, (MB) ASCP Practice Exam Questions with Answers Graded A+
deletes a restriction site, yielding a fragment of
350 bp. You would expect a heterozygous While at the doctor's office with your father, you
person for gene X to have these fragments on a overheard his physician tell another physician
restriction gel: that test results came in, confirming the presence
+/+ = 350 bp; 250 bp; 100 bp; of the Factor V Leiden mutation, a mutation
m/+ = Only the 350 bp associated with deep venous thrombosis. Which
m/+ = 350 bp; 250 bp; 100 bp of the following is the mutation your father has:
m/m = 350 bp; 250 bp - ANSWER -m/+ = A1691G
350 bp; 250 bp; 100 bp G1619A
1691G>A
C282Y - ANSWER -1691G>A
Which of the following will more likely lower
stringency conditions in the washing step of a
hybridization experiment? Consider the probe sequence,
Increase the concentration of salt in the wash CTACCGTAATATTCGACCGT, to be used in a
solution buffer hybridization procedure. What is the melting
Increase the temperature from, say 68°C to 75°C temperature, Tm, of the sequence?
Use a probe with a higher density of GC base 60°C
pairs as compared to one with a lower GC base 58°C
pair density 64°C
Remove formamide from the wash solution buffer 62°C - ANSWER -58°C
- ANSWER -Increase the concentration of
salt in the wash solution buffer
This polymerase acts on DNA and produces
Ribosomal RNA:
What enzyme is involved in LCR? -
ANSWER -DNA Ligase RNA Pol I
DNA Pol I
RNA Pol II
Next Generation Sequencing set-up require: DNA Pol II - ANSWER -RNA Pol I
Library preparation and extensive bioinformatics
analysis
BAC clones Sickle cell disease is an autosomal genetic
Use of translation factors disease due to a point mutation in the beta-globin
Hybridization - ANSWER -Library gene, where glutamic acid is substituted for
preparation and extensive bioinformatics analysis valine at the sixth codon of the gene, resulting in
a faulty hemoglobin S (Hb S). Sickle cell disease
is one of many genetic diseases where a single
Which of the subunits of RNA polymerase gene controls the expression of many phenotypic
holoenzyme is responsible for promoter traits. The phenomenon where a single gene
recognition? controls the expression of many phenotypic traits
Beta subunit is best referred to as: - ANSWER -
Sigma subunit Pleiotrophy
Gamma subunit
Delta subunit - ANSWER -Sigma subunit
What assay amplifies the target using a