BIO 235 - Final Exam Study Guide
The Central Dogma of molecular biology states that, in cells, biological information
_______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - Correct Answers -B
What is the exception to the Central Dogma rule? - Correct Answers -RETROVIRUSES
(process goes from RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - Correct Answers
-Reverse transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - Correct Answers –D
Heterogametic sex - Correct Answers -Produce two different types of gametes with
respect to the sex chromosomes (male mammals)
Homogametic sex - Correct Answers -Produce gametes that are all the same with
respect to the sex chromosomes (female mammals)
Which of the following is true concerning the inheritance of a dominant trait?
A. Every affected person must have one affected parent.
B. The trait is observed in every generation.
C. An affected heterozygote will transmit the allele to half of his or her offspring.
D. All of the above
E. None of the above - Correct Answers -D
Copy-and-paste transposons a.k.a. replicative transposition - Correct Answers -A new
copy of the transposable element is introduced at a new site while the old copy remains
,behind at the original site (so the number of copies of the transposable element
increases)
Transposons a.k.a. transposable elements - Correct Answers -Sequences that can
move about in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - Correct Answers -NO
Are inverted repeats part of a transposon? - Correct Answers -YES
Transposition - Correct Answers -The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - Correct Answers -
Transposable element excises from the old site and inserts at a new site WITHOUT any
increase in the number of its copies
Retrotransposons - Correct Answers -Elements that transpose through an RNA
intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - Correct Answers -C
Base analogs - Correct Answers -Chemicals with structures similar to that of any of the
four standard bases of DNA (DNA polymerase canNOT distinguish these analogs from
the standard bases)
Alkylating agents - Correct Answers -Chemicals that donate alkyl groups like methyl and
ethyl groups
Deamination - Correct Answers -Removing an amino group
Intercalating agents - Correct Answers -Produce mutations by sandwiching themselves
(intercalating) between adjacent bases in DNA, distorting the three-dimensional
structure of the helix and causing single-nucleotide insertions and deletions in
replication
What form of radiation causes double-strand breaks in DNA? - Correct Answers -X-rays
(ionizing radiation)
, What form of radiation forms pyrimidine dimers (or thymine dimers)? - Correct Answers
-UV rays
Pyrimidine dimers - Correct Answers -Formation of a chemical bond between adjacent
pyrimidine molecules on the same strand of DNA
Depurination - Correct Answers -The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - Correct Answers -D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space - Correct Answers -C
Primary structure of a protein - Correct Answers -Sequence of amino acids
Secondary structure of a protein - Correct Answers -Interactions between neighboring
amino acids causing a polypeptide chain to fold and twist (alpha helix and beta pleated
sheet - regional folding)
Tertiary structure of a protein - Correct Answers -Overall-three dimensional shape of the
protein (when secondary structures fold even further)
Quaternary structure - Correct Answers -When two or more polypeptide chains
associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - Correct Answers -E (wobble takes place on the THIRD position
of a codon and the FIRST position of the anticodon)
The Central Dogma of molecular biology states that, in cells, biological information
_______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - Correct Answers -B
What is the exception to the Central Dogma rule? - Correct Answers -RETROVIRUSES
(process goes from RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - Correct Answers
-Reverse transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - Correct Answers –D
Heterogametic sex - Correct Answers -Produce two different types of gametes with
respect to the sex chromosomes (male mammals)
Homogametic sex - Correct Answers -Produce gametes that are all the same with
respect to the sex chromosomes (female mammals)
Which of the following is true concerning the inheritance of a dominant trait?
A. Every affected person must have one affected parent.
B. The trait is observed in every generation.
C. An affected heterozygote will transmit the allele to half of his or her offspring.
D. All of the above
E. None of the above - Correct Answers -D
Copy-and-paste transposons a.k.a. replicative transposition - Correct Answers -A new
copy of the transposable element is introduced at a new site while the old copy remains
,behind at the original site (so the number of copies of the transposable element
increases)
Transposons a.k.a. transposable elements - Correct Answers -Sequences that can
move about in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - Correct Answers -NO
Are inverted repeats part of a transposon? - Correct Answers -YES
Transposition - Correct Answers -The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - Correct Answers -
Transposable element excises from the old site and inserts at a new site WITHOUT any
increase in the number of its copies
Retrotransposons - Correct Answers -Elements that transpose through an RNA
intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules
are called ________, whereas mutagenic compounds that cause the covalent
attachment of a methyl or an ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - Correct Answers -C
Base analogs - Correct Answers -Chemicals with structures similar to that of any of the
four standard bases of DNA (DNA polymerase canNOT distinguish these analogs from
the standard bases)
Alkylating agents - Correct Answers -Chemicals that donate alkyl groups like methyl and
ethyl groups
Deamination - Correct Answers -Removing an amino group
Intercalating agents - Correct Answers -Produce mutations by sandwiching themselves
(intercalating) between adjacent bases in DNA, distorting the three-dimensional
structure of the helix and causing single-nucleotide insertions and deletions in
replication
What form of radiation causes double-strand breaks in DNA? - Correct Answers -X-rays
(ionizing radiation)
, What form of radiation forms pyrimidine dimers (or thymine dimers)? - Correct Answers
-UV rays
Pyrimidine dimers - Correct Answers -Formation of a chemical bond between adjacent
pyrimidine molecules on the same strand of DNA
Depurination - Correct Answers -The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - Correct Answers -D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation
of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in
space - Correct Answers -C
Primary structure of a protein - Correct Answers -Sequence of amino acids
Secondary structure of a protein - Correct Answers -Interactions between neighboring
amino acids causing a polypeptide chain to fold and twist (alpha helix and beta pleated
sheet - regional folding)
Tertiary structure of a protein - Correct Answers -Overall-three dimensional shape of the
protein (when secondary structures fold even further)
Quaternary structure - Correct Answers -When two or more polypeptide chains
associate
When codons that specify the same amino acid differ in ________, a single tRNA may
be able to anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - Correct Answers -E (wobble takes place on the THIRD position
of a codon and the FIRST position of the anticodon)
