MB ASCP CONNECT UPDATED
Questions and CORRECT Answers
What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17) - CORRECT ANSWER - t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the
probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5% - CORRECT ANSWER - 92.5 %
Multiply all PI together = CPI
,(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation - CORRECT ANSWER - Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site - CORRECT ANSWER - Hairpin loops
Which of the following statements are characteristics of the melt curve analysis? (hint: more than
one answer)
,a. At the melting point, the probe separates from the target strand and fluorescence rapidly
decreases.
b. The melting temperature of double stranded DNA depends on its base composition and length.
c. All PCR products for a specific primer pair should have the same melting temperature.
d. When hybridization probes are utilized, the temperature is incrementally decreased while
fluorescence is monitored. - CORRECT ANSWER - At the melting point, the probe
separates from the target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition and length.
All PCR products for a specific primer pair should have the same melting temperature.
In the field of molecular diagnostics, which one of the following genes is responsible for the
synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes - CORRECT ANSWER - Proto-oncogenes
Microsatellite instability is best described as:
a. The ability of a gene with repeating elements of 8-10 base pairs to randomly mutate
b. Contraction or expansion of the genome caused by frameshift mutations (deletions or
insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs
c. Repetitive elements in the genome with the ability to self-prime, thus creating additional
copies of genetic material at the allele loci
d. Random gene rearrangement between repeating elements of the same size on different
chromosomes resulting in different size gene products - CORRECT ANSWER -
Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions)
in elements of the genome consisting of a repeating sequence of 1-3 base pairs
, Purines and pyrimidines differ from each other in that:
a. Purines are found RNA; pyrimidines are found in DNA
b. There's no difference between purines and pyrimidines
c. Pyrimidines have two rings; purines have one ring
d. Purines have two rings; pyrimidines have one ring - CORRECT ANSWER - Purines
have two rings; pyrimidines have one ring
TIP: Reciprocals of each other.
Purine, shorter word, longer rings.
Pyrimidine, longer word, shorter ring.
Which of the following molecular methodologies would be the best for detecting a trinucleotide
repeat disorder such as Huntington's disease?
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR - CORRECT ANSWER - Variable number tandem repeat
analysis
Locus Test C M PF1 PF2
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6
Questions and CORRECT Answers
What is translocation is associated with Burkitt's Lymphoma?
a. t(18; 14)
b. t(9; 22)
c. t(8; 14)
d. t(15; 17) - CORRECT ANSWER - t(8; 14)
TIP: Burkkitt's 8 letters,
Locus PF Child Paternity Index
LOC-A1 3 2/3 2.18
LOC-B2 7/5 5 0.798
LOC-C3 17/17 9/17 5.21
LOC-D4 12 12 1.37
Based on the data presented in the table above and with a prior probability (PP) of 0.5, the
probability of paternity in this case is :
a. 92.5%
b. 99.5%
c. 90.5 &
d. 95.5% - CORRECT ANSWER - 92.5 %
Multiply all PI together = CPI
,(CPI x PP) / [CPI x P + (1 - PP)
OR ...
CPI / (1 + CPI)
You have sequenced a gene and observe the following:
Reference: atgctggcacgacaggtttcccgactgg
Sequenced: atgCctggcacgacaggtttcccgactgg
The mutation observed is a:
a. Frame-shift mutation
b. Insertion
c. Silent mutation
d. Non-conservative mutation - CORRECT ANSWER - Frame-shift mutation
Which of the following is not involved in the splicing reaction?
a. 5' splice site
b. Hairpin loops
c. Branch A point
d. 3' splice site - CORRECT ANSWER - Hairpin loops
Which of the following statements are characteristics of the melt curve analysis? (hint: more than
one answer)
,a. At the melting point, the probe separates from the target strand and fluorescence rapidly
decreases.
b. The melting temperature of double stranded DNA depends on its base composition and length.
c. All PCR products for a specific primer pair should have the same melting temperature.
d. When hybridization probes are utilized, the temperature is incrementally decreased while
fluorescence is monitored. - CORRECT ANSWER - At the melting point, the probe
separates from the target strand and fluorescence rapidly decreases.
The melting temperature of double stranded DNA depends on its base composition and length.
All PCR products for a specific primer pair should have the same melting temperature.
In the field of molecular diagnostics, which one of the following genes is responsible for the
synthesis of DNA, promote cell division, and inhibit cell death?
a. Proto-oncogenes
b. Tumor suppressor genes
c. Oncogenes
d. Mitochondrial genes - CORRECT ANSWER - Proto-oncogenes
Microsatellite instability is best described as:
a. The ability of a gene with repeating elements of 8-10 base pairs to randomly mutate
b. Contraction or expansion of the genome caused by frameshift mutations (deletions or
insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs
c. Repetitive elements in the genome with the ability to self-prime, thus creating additional
copies of genetic material at the allele loci
d. Random gene rearrangement between repeating elements of the same size on different
chromosomes resulting in different size gene products - CORRECT ANSWER -
Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions)
in elements of the genome consisting of a repeating sequence of 1-3 base pairs
, Purines and pyrimidines differ from each other in that:
a. Purines are found RNA; pyrimidines are found in DNA
b. There's no difference between purines and pyrimidines
c. Pyrimidines have two rings; purines have one ring
d. Purines have two rings; pyrimidines have one ring - CORRECT ANSWER - Purines
have two rings; pyrimidines have one ring
TIP: Reciprocals of each other.
Purine, shorter word, longer rings.
Pyrimidine, longer word, shorter ring.
Which of the following molecular methodologies would be the best for detecting a trinucleotide
repeat disorder such as Huntington's disease?
a. Heteroduplex analysis
b. Variable number tandem repeat analysis
c. Single strand conformation polymorphism analysis
d. Reverse-Transcriptase PCR - CORRECT ANSWER - Variable number tandem repeat
analysis
Locus Test C M PF1 PF2
A1 12/15 12 15/17 12/15
B2 13 13/13 13/15 14/15
C3 7/8 8 7 7/7
D4 9/11 9/9 10/11 11
E5 6 6/6 5/7 6