TEST BANK FOR GENETICS AND GENOMICS IN NURSINGAND HEALTH CARE 2ND EDITIONBY BEERY

TEST BANK FOR GENETICS AND GENOMICS IN NURSINGAND HEALTH CARE 2ND EDITIONBY BEERY TEST BANK FOR GENETICS AND GENOMICS IN NURSINGAND HEALTH CARE 2ND EDITIONBY BEERY SOLUTION MANUAL FOR ALL QUESTIONS AND ANSWERS SUCCESS A+ Chapter 1: DNA Structure and Function Multiple Choice Identify the choice that best completes the statement or answers the question. A. 1. In which body or cell area are most genes in humans located? A. Nucleus B. Mitochondrion C. Cytoplasm D. Plasma membrane A. 2. Which condition or statement exemplifies the concept of genomics rather than genetics? A. The gene for insulin is located on chromosome 11 in all people. B. Expression of any single gene is dependent on inheriting two alleles. C. Sex-linked recessive disorders affect males more often than females. D. One allele for each gene is inherited from the mother, and one is inherited from the father. A. 3. What is the purpose of phosphorous in a DNA strand? A. Linking the nucleotides into a strand B. Holding complementary strands together C. Ensuring that a purine is always paired with a pyrimidine D. Preventing the separation of double-stranded DNA into single-stranded DNA A. 4. What is the term used to define alternative forms of a gene that may result in different expression of the trait coded for by that gene? A. Alleles B. Bases C. Centromeres D. Diploids D. 5. What percentage of bases in a stretch of double-stranded DNA that contains 30% guanine (G) bases would be adenine (A)? A. 70% B. 60% C. 30% D. 20% C. 6. What is the term used to describe the organized picture of the paired chromosomes within a cell used to determine whether chromosome numbers, structures, and banding patterns are normal? A. Pedigree B. Phenotype C. Karyotype D. Autotype D. 7. What would be the sequence of DNA that is complementary to a DNA section with the base sequence of GGTCAATCCTTAG? A. GATTCCTAACTGG B. TTGACCGAAGGCT C. AACTGGCTTCCGA D. CCAGTTAGGAATC B. 8. Which of these complementary base pairs form the strongest or “tightest” association? A. Adenine and thymine B. Cytosine and guanine C. Guanine and thymine D. Cytosine and adenine A 9. What activity occurs during M phase of the cell cycle? A. The cell undergoes cytokinesis. B. Activity stops, and the cell “sleeps.” C. All DNA is completely replicated. D. The cell greatly increases protein synthesis. B. 10. Which chromosome number represents the euploid state for normal human somatic cells? A. 44 B. 46 C. 47 D. 48 A. 11. How does the proteome differ from the genome? A. The proteome changes in response to intracellular and extracellular signals. B. The genome changes in response to intracellular and extracellular signals. C. The proteome is stable in somatic cells and unstable in germ cells, whereas the genome is stable in both somatic cells and germ cells. D. The genome is stable in somatic cells and unstable in germ cells, whereas the proteome is stable in both somatic cells and germ cells. C. 12. What is the most outstanding feature of a mature haploid cell? A. It is usually homozygous. B. The sex chromosomes are missing. C. Only one chromosome of each pair is present. D. DNA synthesis occurs after mitosis instead of before. D. 13. At what phase of the cell cycle are chromosomes visible as separate structures? A. G1 B. G2 C. S D. M B. 14. Which statement about the cell cycle phase of G0 is true? A. Hyperplastic growth in place of hypertrophic growth B. Performance of specific differentiated functions C. Initiation and completion of nucleokinesis D. Replication of DNA B. 15. What is the result of normal DNA replication? A. Formation of two new daughter cells B. Formation of two identical sets of DNA C. Disappearance of the original parent cell D. Activation and attachment of spindle fibers A. 16. Which statement regarding chromosome structure or function is true? A. The chromatids of any single chromosome are known as “sister chromatids.” B. The genes located on the telomeres of chromosomes are identical to the genes in the centromeres. C. Immediately before the mitosis phase of cell division, the chromosomes of all somatic cells are haploid. D. A specific gene allele on one chromosome has a complementary allele on the other chromosome of a pair. C. 17. Why does a person with normal chromosomes only have two alleles for any single gene trait? A. A minimum of two alleles is required for the expression of monogenic traits. B. When a dominant allele is paired with a recessive allele, only the dominant allele is expressed, and the recessive allele is silent. C. One allele for the monogenic trait is on the paternally derived chromosome, and the other allele is on the maternally derived chromosome. D. Expression of more than two alleles of any single-gene trait results in enhanced expression of recessive alleles and suppressed expression of dominant alleles. C 18. Under what normal condition are genotype and phenotype always the same? A. Euploidy of alleles B. Aneuploidy of alleles C. Homozygosity of alleles D. Heterozygosity of alleles D. 19. What would be the expected result of a drug that affected a particular tissue by causing new DNA to form with covalent bonds instead of hydrogen bonds? A. None of the cells in the affected tissue would be able to leave G0 and enter the cell cycle. B. Replication of DNA would result in identical DNA strands instead of complementary strands. C. Mitosis of cells in the tissue would result in the production of three new daughter cells instead of just two. D. The new cells that formed within this tissue would not be able to complete the next round of mitosis successfully. B. 20. How does the DNA enzyme topoisomerase contribute to DNA replication? A. Unwinds the double helix and separates the double-stranded DNA B. Creates a “nick” in the DNA supercoils, allowing them to straighten before replication C. Initiates DNA synthesis in multiple sites down the strand, making the process more efficient D. Connects and links the individual pieces of newly synthesized DNA to form a single strand A. 21. Where is telomeric DNA located? A. At the tips of the p and q arms of chromosomes. B. In the mitochondria of all somatic cells C. Only in the germ cells (ova and sperm) D. Within the histones of the solenoid A. 22. What is the purpose of a chromosome centromere? A. Connecting sister chromatids to form a chromosome B. Preventing the chromosome arm tips from unraveling C. Allowing chromatids to separate during DNA replication D. Ensuring that DNA replication proceeds only in the 3'-to-5' direction C. 23. Which genetic process would be disrupted in one cell if it could not form chromosomes? A. DNA replication B. Gene-directed protein synthesis C. Delivery of genetic information to new cells D. Conversion of a nucleoside into a nucleotide B. 24. What are the expected expressed blood types of children born to a mother who is B/O for blood type and a father who is A/B for blood type? A. 25% A, 25% B, 25% O, 25% AB B. 25% A, 50% B, 0% O, 25% AB C. 50% A, 25% B, 25% O, 0% AB D. 50% A, 25% B, 0% O, 25% AB A. 25. A person’s karyotype shows 44 autosomes and one X chromosome. What is the best interpretation of this karyotype? A. The karyotype is aneuploid, and the individual has only one allele for each of the genes on the X chromosome. B. The karyotype is aneuploid, and the individual is experiencing the pathologic condition of haploidy. C. The karyotype is euploid, making the individual a genotypic female and a phenotypic male. D. The karyotype is euploid, making the individual a genotypic male and a phenotypic female. References Beery, T. A., Workman, M. L., & Eggert, J. A. (2018). Genetics and Genomics in Nursing and Health Care 2nd Edition. Retrieved from Davis Plus: Chapter 2: Protein Synthesis Multiple Choice Identify the choice that best completes the statement or answers the question. C. 1. What is the relationship among genes, DNA, and proteins? A. DNA is composed of a series of amino acids that provide the directions for synthesizing proteins. B. Protein is composed of DNA that is organized into specific gene sequences called amino acids. C. A gene is a section of DNA that provides the directions for synthesizing a specific protein. D. Proteins are the nitrogenous bases that form double strands of DNA in its helical shape. B. 2. What is the best meaning for the term gene expression? A. The location of a specific gene allele on a specific autosomal chromosome B. The specific trait or protein coded for by a single gene is actually present C. The ability of a single gene to code for more than one trait or characteristic D. The loss of a trait or characteristic from one family generation to the next generation D. 3. What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis? A. Transcription for DNA synthesis is rapidly followed by the process of translation. B. Transcription for protein synthesis has “greater fidelity” than does transcription for DNA synthesis. C. Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. D. Transcription for DNA synthesis occurs with both the “sense” and the “antisense” strands, while transcription for protein synthesis occurs with only the “antisense” strand. A 4. Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA A. AUGGUUAUUA B. ACGCTCGATTATTT C. CGCUCGAUUAUUU D. AACGCUUGGUCUGAAUUUUAAUUU B. 5. What is the function of ribosomes (also known as ribosomal RNA) in protein synthesis? A. Allow interpretation of the two strands of DNA to determine which is the “sense” strand and which is the “antisense” strand B. Serve as the coordinator mechanism to allow proper reading of the mRNA and placement of the correct amino acid in the sequence by the tRNAs C. Allow further processing of synthesized proteins (posttranslational modification) in order to ensure that the final product is physiologically active D. Serve as transport molecules able to move a specific amino acid to the site of protein synthesis (peptide chain elongation) in the correct sequence D. 6. A strand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA? A. 1, 2, 3, 4, 5, 6, 7, 8 B. 2, 3, 4, 5, 6, 7 C. 1, 2, 4, 8 D. 3, 5, 6, 7 D. 7. Which process occurs outside of the nucleus? A. DNA transcription B. RNA transcription C. Splicing out of introns D. Translation of mRNA C. 8. What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell? A. Increased rate of mRNA degradation B. Increased formation of mutation “hot spots” C. Decreased production of cellular proteins D. Decreased amounts of uracil in the cytoplasm A. 9. Which process would be directly inhibited by a lack of conversion of thymine to uracil? A. Translation B. Transcription C. MicroRNA silencing D. Posttranscriptional modification C. 10. What would be the sequence of RNA complementary to single-stranded DNA with the base sequence of ACCTGAACGTCGCTA? A. TGGACTTGCAGCGAT B. ACCTGAACGTCGCTA C. UGGACUUGCAGCGAU D. ACCUGAACGUCGCUA A. 11. Which events, structures, or processes are likely to trigger transcription of the beta-globin gene? A. Anemia and TATA boxes upstream from the beta-globin gene B. Anemia and polyadenylation downstream from the beta-globin gene C. Polycythemia and TATA boxes upstream from the beta-globin gene D. Polycythemia and polyadenylation downstream from the beta-globin gene C. 12. After a protein is synthesized during translation, what further process or processes is/are needed for it to be fully functional? A. No further processing beyond the linear arrangement of amino acids is required. B. Although minimal function can occur in the linear form, the protein is more active when it undergoes mitosis. C. The protein first twists into a secondary structure and then “folds” into a specific tertiary structure for activation and function. D. The initial protein produced is a “preprotein” that requires a series of depolarizations by electrical impulses for conversion to an active protein. C. 13. How does an “anticodon” participate in protein synthesis? A. Splicing out the introns to form a functional and mature messenger RNA B. Identifying which DNA strand is the “sense” strand to transcribe into RNA C. Ensuring the appropriate tRNA places the correct amino acid into the protein D. Interpreting the correct “stop” triplet or codon that signals for translation termination C. 14. The protein glucagon contains 29 amino acids in its active linear form. What is the minimum number of bases present in the mature messenger RNA for this protein? A. 29 B. 58 C. 87 D. 116 B. 15. Which feature or characteristic is most critical for protein function or activity? A. The number of amino acids B. The sequence of amino acids C. Deletion of all active exons D. Transcription occurring after translation D. 16. How does a “codon” participate in protein synthesis? A. Carrying amino acid for peptide bond attachment B. Ensuring that ribosomal RNA is securely wrapped around the mature mRNA C. Preventing microRNA from binding to mRNA and prematurely degrading it D. Indicating which amino acid is to be placed within the growing protein chain A. 17. How does replacement of thymine with uracil in messenger RNA help in the process of protein synthesis? A. Allowing messenger RNA to leave the nucleus B. Ensuring only the “antisense” strand of DNA is transcribed C. Determining the placement of the “start” signal for translation D. Promoting posttranslational modification for conversion to an active protein D. 18. How does the process of polyadenylation affect protein synthesis? A. Binding to the antisense DNA strand to prevent inappropriate transcription B. Promoting attachment of ribosomes to the correct end of messenger RNA C. Linking the exons into the mature messenger RNA D. Signaling the termination of mRNA translation A. 19. Why are ribonucleases that digest mature messenger RNA a necessary part of protein synthesis? A. These enzymes prevent overexpression of critical proteins. B. Without ribonucleases, messenger RNA could leave one cell type and lead to excessive protein synthesis in a different cell type. C. When ribonucleases degrade RNA, the degradation products are recycled, making protein synthesis more energy efficient. D. The activity of these enzymes promotes increased translation of individual messenger RNAs so that fewer RNA molecules are needed for protein production. D. 20. Which statement about the introns within one gene is correct? A. These small pieces of DNA form microRNAs that regulate gene expression. B. They are part of the desert DNA composing the noncoding regions. C. When expressed, they induce posttranslational modifications. D. The introns of one gene may be the exons of another gene. B. 21. Which DNA segment deletion would cause a frameshift mutation? A. TCT B. GAGTC C. TACTAC D. GCATGACCC C. 22. A person who is worried that he may have inherited the gene mutation for Huntington disease is told that he has the “wild-type” form of this gene. What is the best interpretation of this finding? A. His gene for Huntington disease (HD) has more “hot spots” for mutations than the general population. B. His Huntington disease has unusual mutations of unknown significance. C. His Huntington disease gene is considered normal. D. He has no Huntington disease gene. C. 23. What is the expected result of a “nonsense” point mutation? A. Total disruption of the gene reading frame, no production of protein B. Replacement of one amino acid with another in the final gene product C. Replacing an amino acid codon with a “stop” codon, resulting in a truncated protein product D. No change in amino acid sequence and no change in the composition of the protein product D. 24. What makes a frameshift mutational event more serious than a point mutational event? A. Frameshift mutations occur primarily in germline cells, and point mutations occur only in somatic cells. B. Frameshift mutations result in the deletion or addition of whole chromosomes (aneuploidy), and point mutations are undetectable at the chromosome level. C. The rate of frameshift mutations increases with aging because DNA repair mechanisms decline, whereas the rate of point mutations is unchanged with age. D. When the mutations occur in expressed genes, frameshift mutations always result in disruption of the gene function, whereas a point mutation can be silent. A. 25. What is the expected outcome when a person (twin A) experiences a large deletion of DNA in one of his noncoding regions and his monozygotic twin (twin B) does not? A. DNA identification of each twin will be more specific. B. Only their somatic cells will remain identical at all loci. C. Only their germline cells will remain identical at all loci. D. They will now be dizygotic twins instead of monozygotic twins. D. 26. Which statement about single-nucleotide polymorphisms (SNPs) is true? A. SNPs can change an exon sequence into an intron sequence. B. SNPs can change an intron sequence into an exon sequence. C. SNPs are generally responsible for frameshift mutations. D. SNPs are generally responsible for point mutations.