1
For Expert help and assignment solutions, +254707240657
MB ASCP Questions and Answers (100%
Correct Answers) Already Graded A+
What genes would be screened in a lung cancer panel? [ ANS: ]
KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: [ ANS: ] Genome and mRNA
To what does the AcrAB gene product create resistance to? [
ANS: ] Tetracycline
© 2025 Assignment Expert
What gene is measured following the treatment with
imatinib(Gleevec)? [ ANS: ] BCR/Abl
Blood drawn into what type of tube is compatible for genetic
testing? [ ANS: ] K2-EDTA tube
Guru01 - Stuvia
Primer dimers are due to what complimentary issue? [ ANS: ] 3' to
3' complementarity of primer pairs
Microsatellite instability is best described as: [ ANS: ] Contraction or
expansion of the genomes caused by frameshift mutations
(deletions or insertions) in elements of the genome consisting of a
repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base
pair? [ ANS: ] 3
When this enzyme finds nicks or gaps in the sugar-phosphate
backbone of DNA, it closes them [ ANS: ] Ligase
What assay amplifies the target using DNA ligase? [ ANS: ] LCR
What genes would be screened in a breast cancer panel? [ ANS: ]
HER2, ERBB2, BRCA1
What factors can affect nucleic acid hybridization? [ ANS: ] G:C
ratio of bases
, 2
For Expert help and assignment solutions, +254707240657
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What
percent chance do these parents combined have to pass down
this affected gene to their child? [ ANS: ] 75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be
used in a hybridization procedure. What is the melting
temperature, Tm, of the sequence? [ ANS: ] 58*C
The enzyme that primes DNA synthesis is: [ ANS: ] DNA primase
© 2025 Assignment Expert
Splicing is the process that: [ ANS: ] Removes introns and preserves
exons
All of the following enzymes are part of the DNA replication
Guru01 - Stuvia
machinery [ ANS: ] Ligase, DNA polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene
on one chromosome and the BCR gene on the other
chromosome, resulting in chronic myelogenous leukemia (CML): [
ANS: ] t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3'
which is the appropriate sense strand? [ ANS: ] 5'-
ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target
amplification: [ ANS: ] Quantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex? [ ANS: ] SYBR1
The purines are: [ ANS: ] Adenine and guanine
For Expert help and assignment solutions, +254707240657
MB ASCP Questions and Answers (100%
Correct Answers) Already Graded A+
What genes would be screened in a lung cancer panel? [ ANS: ]
KRAS, EGFR, ALK
In a retrovirus, the RNA acts as: [ ANS: ] Genome and mRNA
To what does the AcrAB gene product create resistance to? [
ANS: ] Tetracycline
© 2025 Assignment Expert
What gene is measured following the treatment with
imatinib(Gleevec)? [ ANS: ] BCR/Abl
Blood drawn into what type of tube is compatible for genetic
testing? [ ANS: ] K2-EDTA tube
Guru01 - Stuvia
Primer dimers are due to what complimentary issue? [ ANS: ] 3' to
3' complementarity of primer pairs
Microsatellite instability is best described as: [ ANS: ] Contraction or
expansion of the genomes caused by frameshift mutations
(deletions or insertions) in elements of the genome consisting of a
repeating sequence of 1-3 base pairs
How many hydrogen bonds are formed between one C:G base
pair? [ ANS: ] 3
When this enzyme finds nicks or gaps in the sugar-phosphate
backbone of DNA, it closes them [ ANS: ] Ligase
What assay amplifies the target using DNA ligase? [ ANS: ] LCR
What genes would be screened in a breast cancer panel? [ ANS: ]
HER2, ERBB2, BRCA1
What factors can affect nucleic acid hybridization? [ ANS: ] G:C
ratio of bases
, 2
For Expert help and assignment solutions, +254707240657
pH of the hybridization reaction
Hybridization temperature
Both parents are carriers of an autosomal recessive disorder. What
percent chance do these parents combined have to pass down
this affected gene to their child? [ ANS: ] 75%
Consider the probe sequence, CTACCGTAATATTCGACCGT, to be
used in a hybridization procedure. What is the melting
temperature, Tm, of the sequence? [ ANS: ] 58*C
The enzyme that primes DNA synthesis is: [ ANS: ] DNA primase
© 2025 Assignment Expert
Splicing is the process that: [ ANS: ] Removes introns and preserves
exons
All of the following enzymes are part of the DNA replication
Guru01 - Stuvia
machinery [ ANS: ] Ligase, DNA polymerase, Helicase
This translocation creates a fusion protein between the Abl1 gene
on one chromosome and the BCR gene on the other
chromosome, resulting in chronic myelogenous leukemia (CML): [
ANS: ] t(9;22)
Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3'
which is the appropriate sense strand? [ ANS: ] 5'-
ATCTATGTCGGCAATT-3'
All of the following methods of amplification are considered target
amplification: [ ANS: ] Quantitative PCR
Strand Displacement Amplification
Reverse Transcriptase PCR
What stain binds to minor groove of DNA Duplex? [ ANS: ] SYBR1
The purines are: [ ANS: ] Adenine and guanine
