Bio 30 Test questions With Complete Solutions!!!

How many unique 10 base pair sequences can you encode with DNA - ANS 4^10 In the Hershey and Chase experiments, radioactive sulfur was used to label bacteriophage protein and radioactive phosphorus was used to label bacteriophage DNA. If protein was the heritable material, which of the following results would you expect? - ANS Most of the labeled S inside the cell You know that a strand of DNA contains 30% Adenine. What percentage of the DNA is Cytosine? - ANS 20% Which of the following biomolecule could encode the most unique sequences of length 5? - ANS Protein Which of the following is the complementary strand to the following DNA sequence: ATGTC? - ANS TACAG Which of the following is the sequence of the mRNA that would be made using the following DNA template strand: ATGTC - ANS UACAG Griffith found that injecting mice with live, but not heat killed S cells killed the mouse. Injecting mice with R cells did not kill the mice, but if heat killed S cells were co-injected with live R cells the mice died. What can you conclude from these experiments? - ANS Something from the heat killed S cells can be passed to the R cells to make them lethal In Avery's experiments he isolated the S factor. What do you predict would happen if he mixed the S factor with a protease and then put the resulting mix onto a plate of R cells? - ANS They will transform to S cells Which of the following could be used as a positive control in the Avery experiments? - ANS S factor If Meselson and Stahl grew their bacteria on media with only the light N14 isotope and centrifuged the resulting DNA, how many bands do you expect them to see? - ANS 1 band If DNA was conservative, after one generation how many density bands would you expect? - ANS 2 Which type of chemical bond occurs between A and T bases in complementary DNA strands? - ANS Hydrogen bonds Meselson and Stahl determined that DNA replication is: - ANS semi-conservative What structure is shown with two -OH attached - ANS ATP In an adult, which of the following epigenetic changes do you expect to see in the fetal hemoglobin gene? - ANS hypermethylated Which of the following is the definition of the central dogma of molecular biology? - ANS DNA transcribed to RNA which then translates to Protein If you radioactively label the amino acid serine, which type of RNA do you expect is most likely to be found bound to the serine? - ANS tRNA You are studying regulation of two genes: Actin and the Clock gene. Actin is constantly required for maintenance of the cell's cytoskeleton, while the Clock gene varies in expression over the course of the day and helps set the circadian rhythm. Which gene do you expect to be transcribed at different rates over the course the day? Clock mRNA Actin mRNA - ANS Actin mRNA Use the codon table to determine how many amino acids are in the protein that will be translates from the following mRNA sequence: AUGGCUGAUCCUAUUACUCCUUGA - ANS 8 You set up an in vitro experiment to test the hypothesis that ricin inhibits protein translation. Which of the following substances must be included in the test tube to allow for the synthesis of ProteinA? - ANS Cystic Fibrosis is an autosomal recessive disorder. What is the probability that a child will get Cystic Fibrosis if the mother is heterozygous and the father is homozygous recessive? - ANS 1 in 2 or 50% After meiosis in an organism that is a tetraploid, what composition of the cells do you expect? - ANS Which types of cells undergo cellular fission - ANS Prokaryotes To combine two amino acids, a peptide bond is formed. What type of bond is it? - ANS Ionic Bond Which type of RNA is most similar between a human and a bacterial cell? - ANS If you want to produce two daughter cells with the same DNA as the parent cell, which process should you use? - ANS Mitosis During which phase of mitosis do the sister chromatids separate from each other? - ANS Anaphase A cell undergoes mitosis once, but does not undergo cytokinesis. How many nuclei do you predict the resulting daughter cell will have? - ANS 1 During which phase of meiosis does recombination occur? - ANS Prophase 1 Which types of cells undergo meiosis? - ANS All eukaryotic cells