MBG 1000 Practice Exam 37 Questions with Verified Answers,100% CORRECT
MBG 1000 Practice Exam 37 Questions with Verified Answers Somatic human cells contain: a) 2 pairs of sex chromosomes b) 46 pairs of chromosomes c) 46 chromosomes d) 46 autosomes e) none - CORRECT ANSWER C Which of the following in incorrect: a) a given human somatic cell only has 2 alleles for a given gene b) different alleles of a specific gene often arise through mutation of one of the gene copies c) the alleles of a gene are found at different loci on the 2 copies of the same autosome d) more than one allele of the same gene can cause an altered phenotype - CORRECT ANSWER C Which one of the following best describes mutations that would alter the length and amino acid composition? a) silent b) missense c) nonsense d) frameshift e) 2 of the above - CORRECT ANSWER E Mutations are: a) changes in the amino acid sequence of a protein b) changes in the nucleotide sequence of a gene c) changes in the amino acid sequence of a gene d) changes in the polypeptide sequence of a gene e) changes in the nucleotide sequence of a protein - CORRECT ANSWER B Use this for the next 5 questions - CORRECT ANSWER AAGTACCGGCCCACATTTTTAAAAAAAAGGAAAATCCCAAAA Which mRNA molecule would represent the transcript of the DNA molecule shown above? a)UACCGGCCCACAUUUUUAAAAAAAAGGAAAAUC b)AUGGCCGGGUGUAAAAAUUUUUUUUCCUUUUAG c)TTCATGGCCGGGTGTAAAAATTTTTTTTCCTTTTAGGGTTTT d)UUCAUGGCCGGGUGUAAAAAUUUUUUUUCCUUUUAGGGUUUU e)AAGUACCGGCCCACAUUUUUAAAAAAAAGGAAAAUCCCAAAA - CORRECT ANSWER D Which polypeptide is encoded by the DNA molecule shown above? a) Met-Ala-Gly-Cys-Lys-Asn-Phe-Phe-Ser-Phe-STOP b) Met-Ala-Gly-Cys-Lys-Asn-Phe-Phe-Ser-Phe c) Met-Gly-Gly-Cys-Lys-Asn-Phe-Phe-Ser-Phe-STOP d) Met-Gly-Gly-Cys-Lys-Asn-Phe-Phe-Ser-Phe - CORRECT ANSWER B What is the tRNA anticodon of the fourth amino acid in the protein encoded by the DNA? a) TGT b) UCU c) ACA d) AGA - CORRECT ANSWER C If T is substituted for the underlined A on the DNA template, this mutation would be classified as a: a) Silent mutation b) Missense mutation c) Nonsense mutation d) Frameshift insertion e) Frameshift deletion - CORRECT ANSWER C What is the length of the resultant polypeptide when the mutation in the previous question occurs? a) 3 amino acids b) 4 amino acids c) 5 amino acids d) 10 amino acids e) 11 amino acids - CORRECT ANSWER A Select the most accurate statement. Hypomorphic alleles: a) Are examples of loss-of-function mutations. b) Are examples of gain-of-function mutations. c) Are always dominant. d) Arise due the complete absence of the encoded protein. e) Two of the above are correct. - CORRECT ANSWER A Select the most accurate statement. a) DNA mutations can be corrected by the proof-reading activity of DNA polymerase. b) Nucleotide excision repair is a mechanism often used to correct induced mutations. c) UV radiation can dimerize thymine nucleotides in DNA. d) Unrepaired thymine dimer mutations can result in frameshift deletions to open reading frames. e) All of the above statements are correct. - CORRECT ANSWER E Select the most accurate option. Genes are made of ___(A)___ and encode _____(B)____. a) A = RNA; B = amino acids b) A = Nucleotides; B = sugars c) A = Nucleotides; B= proteins d) A = Chromosomes; B = RNA e) None of the above is correct. - CORRECT ANSWER C Select the incorrect statement regarding Phenylketonuria (PKU). a) PKU is the result of a mutation in the gene encoding the enzyme responsible for converting phenylalanine to phenylpyruvic acid b) Phenylalanine accumulation in the blood causes the disease. c) Symptoms worsen when affected individuals consume high-protein foods. d) It is genetic disease that only shows its phenotype in individuals homozygous for the PKU allele. e) Symptoms include delayed brain development and breath with a musty odour. - CORRECT ANSWER A Which one of the following statements about translation is correct? a) Ribosomes use tRNA molecules to bind mRNA. b) tRNA molecules carry the anticodon that is complementary to codons on mRNA. c) Ribosomes link tRNA molecules together to generate a polypeptide. d) The genetic code represents the anticodons of tRNA molecules. e) Two of the above are correct. - CORRECT ANSWER B Select the most accurate statement. Individuals who are heterozygous for the sickle cell allele: a) are resistant to mosquitoes and therefore do not develop malaria. b) have an increased capacity to block arteries. c) carry mutations that changes glutamine to valine in both copies of the beta-globin gene. d) can form hemoglobin strands and sickle red blood cells in extreme conditions. e) None of the above is correct. - CORRECT ANSWER C Which one of the following statements is most accurate? Sickle Cell Anemia = SCA a) SCA patients prevent the invasion of red blood cells by Plasmodium falciparum merozoites. b) SCA carriers prevent the invasion of red blood cells by Plasmodium falciparum merozoites. c) SCA carriers disrupt the schizogenic cycle of Plasmodium falciparum by targeting parasitized red blood cells for destruction d) Unaffected normal and SCA carriers have similar levels of Plasmodium falciparum blood parasites in malaria-infected regions. e) Two of the above are correct. - CORRECT ANSWER C Which one of the following statements is most accurate? a) Ribosomes use DNA as a template to synthesize proteins in the cytoplasm. b) RNA is translated using DNA as a template. c) RNA polymerase is the enzyme that produces RNA in the nucleus. d) RNA contains deoxyribose in its sugar backbone. e) RNA contains the nucleotide thymine. - CORRECT ANSWER C Which one of the following statements is most accurate? a) Natural selection is the propagation of a genetic variation that provides a species with an advantage in its environment. b) Natural selection is the elimination of an unfavorable genetic variation from a species. c) Genetic variation can be introduced through spontaneous DNA mutation. d) Genetic variation often leads to the changes in the phenotype of an organism or species. e) All of the above is accurate. - CORRECT ANSWER E Which one of the following statements most accurately describes mutations that will result in the Oculocutaneous Type 1A Albinism? a) Null mutation to the tyrosinase gene. b) Decreased function of the transcriptional repressor of the tyrosinase gene. c) Hypomorphic mutation to the tyrosinase gene. d) Mutation that destroys the DNA binding element for the transcriptional activator essential for the transcription of the tyrosinase gene. e) Two of the above statements are correct. - CORRECT ANSWER E Which one of the following statements regarding the phenomenon of a Balanced Polymorphism is the most accurate? a) Only homozygous affected individuals have an advantage. b) Homozygous affected individuals and heterozygous carriers both have an advantage and are present at equal levels in a population. c) The disadvantage of homozygous affected individuals coexisting with the advantage of heterozygous carriers. d) The disadvantage of heterozygous carriers coexisting with the advantage of homozygous affected individuals. e) None of the above is accurate. - CORRECT ANSWER C Select the most accurate statement. Human chromosomes: a) Consist of 1 molecule of DNA before S phase of the cell cycle. b) Consist of 2 molecules of DNA before S phase of the cell cycle. c) Consist of 1 molecule of DNA after S phase of the cell cycle. d) Are located in the cytoplasm of the cell. e) More than one of the above is correct - CORRECT ANSWER A Select the inaccurate statement. a) Chromosomes are loosely packages in M phase. b) The "beads-on-sting" conformation of DNA packaging is easily transcribed. c) Mitotic chromosomes are considered transcriptionally inactive. d) Histones are proteins that package DNA into chromatin. e) Interphase chromosomes contain heterochromatin. - CORRECT ANSWER A Select the incorrect statement. a) Down syndrome is a product of meiotic nondisjunction that occurs in meiosis I in the male parent. b) Down syndrome is a product of meiotic nondisjunction that occurs in meiosis II in the male parent. c) Down syndrome is a product of meiotic nondisjunction that occurs in meiosis I in the female parent. d) 20% of nondisjunction event leading to Down syndrome occurs during oogenesis. e) The incidence of meiotic non-disjunction increases with the increase in maternal age. - CORRECT ANSWER D Select the most accurate statement: a) Classic haemophilia occurs due to severe decrease in blood clotting Factor V. b) Treatments of haemophiliacs are restricted to blood transfusions. c) Haemophiliacs have a decreased ability to produce fibrin needed for blood clot formation. d) Christmas Disease occurs due to a severe decrease in blood clotting Factor VIII. e) All of the above is correct. - CORRECT ANSWER C To exchange genetic material chromosomal chiasmas form only during: a) Prophase of mitosis. b) Metaphase of mitosis. c) Prophase I of meiosis. d) Metaphase I of meiosis. e) Prophase II of meiosis. - CORRECT ANSWER C A man suffers from the same genetic disorder as his mother and one of his two sisters. He marries a woman who is unaffected for this condition and they have five children. All their sons are unaffected while both daughters have the disorder. One daughter marries an unaffected husband. What is the probability of their first child being affected? a) 100% chance the first child will be affected. b) 1⁄2 chance the first child (son or daughter) will be affected. c) A son will be affected, while a daughter will not be affected. d) A daughter will be affected, while a son will not be affected. e) 1⁄4 chance their first child will be affected. - CORRECT ANSWER B What is the mode of inheritance described in the previous question? a) Y-linked inheritance b) X-linked recessive inheritance c) X-linked dominant inheritance d) Autosomal recessive inheritance e) Autosomal dominant inheritance - CORRECT ANSWER C Which one of the following is an example of this mode of inheritance described in the previous question? a) Albinism b) Marfan syndrome c) Coffin-Lowry syndrome d) Male infertility e) Haemophilia - CORRECT ANSWER C Which one of the following correctly indicates the ploidy of human somatic cells during anaphase in mitosis? a) Haploid b) Diploid c) Triploid d) Tetraploid e) None of the above is correct. - CORRECT ANSWER D Select the most accurate statement. Individuals with Down Syndrome a) Have 3 copies of chromosome 13. b) Have 3 copies of chromosome 21. c) Have 3 copies of all chromosomes. d) Have 45 chromosomes. e) None of the above is accurate. - CORRECT ANSWER B Which one of the following statements is most accurate? a) Mutations in the Fibrillin-1 gene of Marfan Syndrome individuals decreases the tissue support provided by connective tissue. b) Connective tissue of Marfan Syndrome individuals lost its elasticity and therefore cannot stretch. c) Microfibrils in elastic fibers of Marfan Syndrome individuals cannot activate TGF-β which leads to uncontrolled growth of many tissues. d) A major symptom of Marfan Syndrome is an enlarged aorta with the risk of rupturing. e) Two of the above. - CORRECT ANSWER E How many chromatids and bivalents chromosomes would be present in meiosis I in the precursor germ-line cell of a normal human male? a) 46 and 23 respectively b) 23 and 46 respectively c) 92 and 23 respectively d) 92 and 46 respectively e) None of the above is correct. - CORRECT ANSWER C Select the inaccurate statement. a) Chromosomes are scattered randomly in the nucleus. b) Histones are proteins that package DNA into nucleosomes. c) The 30nm chromosomal fibre forms part of interphase chromosomes and are transcriptionally active. d) Chromosomes can alternate between loose and dense compaction. - CORRECT ANSWER A Which one of the following statements is most accurate?: a) A single chromosome disjunction event that occurs in meiosis I will generate two aneuploid gametes. b) A single chromosome disjunction event that occurs in meiosis II will generate four aneuploid gametes. c) The gametes produced following a single chromosome disjunction event in meiosis I will always produce zygotes that are aneuploid. d) The gametes produced following a single chromosome disjunction event in meiosis II will always produce zygotes that are aneuploid. e) All the above statements are correct. - CORRECT ANSWER E How many chromatids would be found in a human egg cell (ovum)? a) 23 b) 46 c) 69 d) 92 e) None of the above - CORRECT ANSWER A Seedless commercial grapes, watermelons and oranges are typically a) aneuploids b) trisomics c) autotriploids d) trivalents e) allopolyploids - CORRECT ANSWER C
Written for
- Institution
- MBG 1000 Practice
- Course
- MBG 1000 Practice
Document information
- Uploaded on
- January 26, 2024
- Number of pages
- 9
- Written in
- 2023/2024
- Type
- Exam (elaborations)
- Contains
- Questions & answers
Subjects
-
mbg 1000 practice exam 37 questions with answers