MB ASCP 2024 Exam Grade A

MB ASCP 2024 Exam Grade A What genes would be screened in a lung cancer panel? - Answer ️️ -KRAS, EGFR, ALK In a retrovirus, the RNA acts as: - Answer ️️ -Genome and mRNA To what does the AcrAB gene product create resistance to? - Answer ️️ -Tetracycline What gene is measured following the treatment with imatinib(Gleevec)? - Answer ️️ - BCR/Abl Blood drawn into what type of tube is compatible for genetic testing? - Answer ️️ -K2-EDTA tube Primer dimers are due to what complimentary issue? - Answer ️️ -3' to 3' complementarity of primer pairs Microsatellite instability is best described as: - Answer ️️ -Contraction or expansion of the genomes caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs How many hydrogen bonds are formed between one C:G base pair? - Answer ️️ -3 When this enzyme finds nicks or gaps in the sugar-phosphate backbone of DNA, it closes them - Answer ️️ -Ligase What assay amplifies the target using DNA ligase? - Answer ️️ -LCR What genes would be screened in a breast cancer panel? - Answer ️️ -HER2, ERBB2, BRCA1 What factors can affect nucleic acid hybridization? - Answer ️️ -G:C ratio of bases pH of the hybridization reaction Hybridization temperature Both parents are carriers of an autosomal recessive disorder. What percent chance do these parents combined have to pass down this affected gene to their child? - Answer ️️ -75% Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? - Answer ️️ -58*C The enzyme that primes DNA synthesis is: - Answer ️️ -DNA primase Splicing is the process that: - Answer ️️ -Removes introns and preserves exons All of the following enzymes are part of the DNA replication machinery - Answer ️️ -Ligase, DNA polymerase, Helicase This translocation creates a fusion protein between the Abl1 gene on one chromosome and the BCR gene on the other chromosome, resulting in chronic myelogenous leukemia (CML): - Answer ️️ -t(9;22) Given the anti-sense strand of DNA: 5'-AATTGCCGACATAGAT-3' which is the appropriate sense strand? - Answer ️️ -5'-ATCTATGTCGGCAATT-3' All of the following methods of amplification are considered target amplification: - Answer ️️ -Quantitative PCR Strand Displacement Amplification Reverse Transcriptase PCR What stain binds to minor groove of DNA Duplex? - Answer ️️ -SYBR1 The purines are: - Answer ️️ -Adenine and guanine Purines and pyrimidines differ from each other in that: - Answer ️️ -Purines have two rings; pyrimidines have one ring What gene is measured following treatment with Warfarin? - Answer ️️ -VKORC1 According to Chargaff's rule of base pairing, adenine pairs with: - Answer ️️ -Thymine When comparing 2 samples in a qPCR Amplification plot, a log difference can be seen as approximately: - Answer ️️ -ΔCt = 3.3 The process of making RNA is termed: - Answer ️️ -Transcription When sequencing HLA-DR what is targeted? - Answer ️️ -Exon 2 of the β subunit All of the following are components of nucleic acids: - Answer ️️ -Phosphate group Sugar (ribose or deoxyribose) Nitrogenous base (A,C,G,T) Branched DNA amplification (bDNA) is best classified as: - Answer ️️ -Signal amplification This PCR method works by generating a signal at the annealing step (i.e. when the probe binds its target) of the PCR reaction: - Answer ️️ -Molecular beacons What is the predominant form of DNA? - Answer ️️ -B form Mantle cell lymphoma (MCL) is caused by what translocation? - Answ