MB ASCP CONNECT QUESTIONS AND ANSWERS GRADED A

MB ASCP CONNECT QUESTIONS AND ANSWERS GRADED A What is translocation is associated with Burkitt's Lymphoma? a. t(18; 14) b. t(9; 22) c. t(8; 14) d. t(15; 17) - Answer ️️ -t(8; 14) TIP: Burkkitt's 8 letters, Locus PF Child Paternity Index LOC-A1 3 2/3 2.18 LOC-B2 7/5 5 0.798 LOC-C3 17/17 9/17 5.21 LOC-D4 12 12 1.37 Based on the data presented in the table above and with a prior probability (PP) of 0.5, the probability of paternity in this case is : a. 92.5% b. 99.5% c. 90.5 & d. 95.5% - Answer ️️ -92.5 % Multiply all PI together = CPI (CPI x PP) / [CPI x P + (1 - PP) OR ... CPI / (1 + CPI) You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: a. Frame-shift mutation b. Insertion c. Silent mutation d. Non-conservative mutation - Answer ️️ -Frame-shift mutation Which of the following is not involved in the splicing reaction? a. 5' splice site b. Hairpin loops c. Branch A point d. 3' splice site - Answer ️️ -Hairpin loops Which of the following statements are characteristics of the melt curve analysis? (hint: more than one answer) a. At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. b. The melting temperature of double stranded DNA depends on its base composition and length. c. All PCR products for a specific primer pair should have the same melting temperature. d. When hybridization probes are utilized, the temperature is incrementally decreased while fluorescence is monitored. - Answer ️️ -At the melting point, the probe separates from the target strand and fluorescence rapidly decreases. The melting temperature of double stranded DNA depends on its base composition and length. All PCR products for a specific primer pair should have the same melting temperature. In the field of molecular diagnostics, which one of the following genes is responsible for the synthesis of DNA, promote cell division, and inhibit cell death? a. Proto-oncogenes b. Tumor suppressor genes c. Oncogenes d. Mitochondrial genes - Answer ️️ -Proto-oncogenes Microsatellite instability is best described as: a. The ability of a gene with repeating elements of 8-10 base pairs to randomly mutate b. Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs c. Repetitive elements in the genome with the ability to self-prime, thus creating additional copies of genetic material at the allele loci d. Random gene rearrangement between repeating elements of the same size on different chromosomes resulting in different size gene products - Answer ️️ -Contraction or expansion of the genome caused by frameshift mutations (deletions or insertions) in elements of the genome consisting of a repeating sequence of 1-3 base pairs Purines and pyrimidines differ from each other in that: a. Purines are found RNA; pyrimidines are found in DNA b. There's no difference between purines and pyrimidines c. Pyrimidines have two rings; purines have