DNA Mutation Simulation

Access the simulation at: DNA Mutation Simulation 1) Transcribe and Translate your original DNA. Review those terms and write a short definition Transcription: When a DNA strand gets copied into a new mRNA molecule Translation: When the mRNA genetic code gets decoded in order to make the specific sequence of amino acids in the polypeptide chain 2) Identify the major playersc shown in the simulation: mRNA, Codon, Amino Acid, tRNA, anticodon, ribosome. Use the figure below to label these parts. DOUBLE CLICK ON THE IMAGE TO LABEL THE PARTS. 3. When the protein is completed, write the sequence of amino acids shown, there are 11. (Hint: click the "stop" button to make the model stop jiggling.) MET PRO GLY GLY GLU SER LEU LEU ILE GLY LEU 4. Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCAGGCGGCGAGAGCTTGCTAATTGGCTTATAG 5. Edit the DNA by changing all of the first triplet to AAA Check the new protein created by your new DNA. Describe how this changed the protein. This point mutation changed the protein by changing the sequence that made the first codon code for lysine and not methionine. 6. Return the triplet to its original state (ATG). Now place an additional A after the G, your strand will read ATGA. Check the new protein created by your new DNA. Describe how this changed the protein. This point mutation changed the protein since the final amino acid was ILE and not LEU as well as TRP being added on. 7. Return the triplet to its original state (ATG). Now change the second triplet from CCA to CCC. Check the new protein created by your new DNA. Describe how this changed the protein. This silent mutation did not actually change the chain/protein. Despite the different codons the same amino acid was coded for. Final Analysis - There are three mutations you explored in this activity. You can use what you observed in the activity to help you answer the questions or search other sources if you are still confused. 8. First, you created a POINT mutation in your DNA. Describe what a point mutation is an how this can affect the protein created by the gene. A point mutation affects one or more nucleotides in a sequence, they only affect the amino acid while everything else stays the same. 9. The second mutation you explored is called a FRAMESHIFT mutation. Explain what this means and how it affects the protein. A frameshift mutation gets caused by insertion/deletion in the DNA as well as shifts the sequence which gets read differently (codons get pushed forward/backward) 10. The third mutation you explored is a special kind of point mutation called a SILENT mutation. Explain what this means. A silent mutation means that there was a change in the n