(MB) ASCP Practice Exam Questions ,correct answers latest

(MB) ASCP Practice Exam Questions ,correct answers latestWhich of the following is not a component of a nucleotide? Phosphate group Anti-codon Ribose sugar Nitrogen base Anti-codon According to Chargaff's rule of base pairing, adenine pairs with: Thymine What genes would be screened in a breast cancer panel? HER2, ERBB2, BRCA1 Next Generation Sequencing uses: Short sequence reads Purines and pyrimidines differ from each other in that: Purines have two rings; pyrimidines have one ring The purines are: Cytosine and uracil Adenine and thymine Thymine and cytosine Adenine and guanine Adenine and guanine What is the rate of mutation per round of DNA replication? 1 in 1,000 base pairs 1 in 10,000 base pairs 1 in 1,000,000 base pairs 1 in 1,000,000,000 base pairs 1 in 1,000,000,000 base pairs The rate of DNA migration through an agarose gel during electrophoresis does not depend on which of the following factors? Net charge of the molecule Size of the molecule Shape of the molecule Nucleotide sequence of the molecule Nucleotide sequence of the molecule What are the phases in a qPCR Amplification Plot? Initiation, exponential, plateau Baseline, exponential, plateau Baseline, threshold, exponential, plateau Baseline, initiation, threshold, exponential, plateau Initiation, exponential, plateau Find the palindrome in this restriction enzyme site: 5'-CTGCAG-3'? 5'-GAC 3'-GAC 3'-CTG 5'-GTC 3'-GAC A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntington gene. Testing with standard PCR indicates that patient has Huntington Disease, HD. Which of the following would be consistent with this diagnosis? 25 CAG repeats in the Huntington gene 85 CAG repeats in the Huntington gene 25 CGA repeats in the Huntington gene 85 CGA repeats in the Huntington gene 85 CAG repeats in the Huntington gene Which two HPV types are responsible for most cases of cervical cancer? 16 and 18 31 and 59 16 and 58 44 and 59 16 and 18 Replication forks, known as origins of DNA replication, are created by this enzyme: Ligase Taq Polymerase Primase Helicase Helicase Mutation in what gene is associated with Fragile X syndrome? FMR1 Mantle cell lymphoma (MCL) is caused by what translocation? t(11;14) This polymerase is involved in "initiation of DNA replication and has primase activity": Pol α Its discovery shed light on why there is simultaneous, though not continuous, synthesis of DNA on both leading and lagging strands of DNA: Klenow fragment of DNA polymerase Okazaki fragments Sanger fragments RNA fragments Okazaki fragments What gene is measured following treatment with imatinib (Gleevec)? FLT3 BCR/Abl Jak2 MAPK BCR/Abl What is the rate of mammalian DNA replication? 500 nucleotides per second 100 nucleotides per second 50 nucleotides per second 10 nucleotides per second 50 nucleotides per second This polymerase is involved in "replicates mitochondrial DNA": Pol γ A patient with impaired judgment, personality changes, signs of abnormal body movements and depression comes to the physician's office for a follow-up visit. The physician suspects a single-gene disorder may be the cause of those clinical manifestations. A blood specimen was then sent to your clinical laboratory for mutation screening in the Huntingtin gene. Which of these methods would best accomplish this task? Methylation-specific PCR Standard PCR PFGE RAPD PCR Standard PCR Which of the following storage options is optimal for storing isolated DNA for a period greater than seven years? 22-25ºC 2-8ºC -20ºC -70ºC -70ºC Consider a hypothetical mutation involving gene X. Let's say you amplify a specific exon, say exon 11, of that gene then you cut it with restriction enzyme W. In a person without the mutation, cutting the gene with restriction enzyme W generates two fragments of sizes, 100 bp and 250 bp. Suppose a CT mutation in gene X deletes a restriction site, yielding a fragment of 350 bp. You would expect a heterozygous person for gene X to have these fragments on a restriction gel: +/+ = 350 bp; 250 bp; 100 bp; m/+ = Only the 350 bp m/+ = 350 bp; 250 bp; 100 bp m/m = 350 bp; 250 bp m/+ = 350 bp; 250 bp; 100 bp Which of the following will more likely lower stringency conditions in the washing step of a hybridization experiment? Increase the concentration of salt in the wash solution buffer Increase the temperature from, say 68°C to 75°C Use a probe with a higher density of GC base pairs as compared to one with a lower GC base pair density Remove formamide from the wash solution buffer Increase the concentration of salt in the wash solution buffer What enzyme is involved in LCR? DNA Ligase Next Generation Sequencing set-up require: Library preparation and extensive bioinformatics analysis BAC clones Use of translation factors Hybridization Library preparation and extensive bioinformatics analysis Which of the subunits of RNA polymerase holoenzyme is responsible for promoter recognition? Beta subunit Sigma subunit Gamma subunit Delta subunit Sigma subunit While at the doctor's office with your father, you overheard his physician tell another physician that test results came in, confirming the presence of the Factor V Leiden mutation, a mutation associated with deep venous thrombosis. Which of the following is the mutation your father has: A1691G G1619A 1691GA C282Y 1691GA Consider the probe sequence, CTACCGTAATATTCGACCGT, to be used in a hybridization procedure. What is the melting temperature, Tm, of the sequence? 60°C 58°C 64°C 62°C 58°C This polymerase acts on DNA and produces Ribosomal RNA: RNA Pol I DNA Pol I RNA Pol II DNA Pol II RNA Pol I Sickle cell disease is an autosomal genetic disease due to a point mutation in the beta-globin gene, where glutamic acid is substituted for valine at the sixth codon of the gene, resulting in a faulty hemoglobin S (Hb S). Sickle cell disease is one of many genetic diseases where a single gene controls the expression of many phenotypic traits. The phenomenon where a single gene controls the expression of many phenotypic traits is best referred to as: Pleiotrophy What assay amplifies the target using a combination of a three-enzyme system? Branched DNA TMA PCR NASBA LCR NASBA In what part of a qPCR Amplification Plot do you take your measurement? Exponential phase All of the following are liquid tumors, except: Mantle cell lymphoma Ewing sarcoma Burkitt's lymphoma Acute promyelocytic leukemia Ewing sarcoma A technologist uses the spectrophotometer to quantify the amount of DNA extracted from a blood specimen diluted 1:30. The absorbance reading at 260 nm was found to be 2.545. If the absorbance at 280 nm gave a reading of 1.406, and if the the DNA extract was re-suspended in 0.800 mL of EDTA solution, the DNA yield is: (2.545 * 50ng/mcl)= 127.25 (127.25ng/mcl * 0.30) = 38.175ng/mcl 38.175ng/mcl ( 0.800mL1000) = 3054 micrograms According to the wobble hypothesis, a U in the 5' position of the anit-codon can pair with: U or C A or G A, C or G Only A A or G This polymerase acts on DNA and produces Messenger RNA: RNA Pol II What assay amplifies the probe signal and the probe RNA concentration increases if the target to be detected is present? Branched DNA TMA PCR NASBA LCR Qβ replicase Qβ replicase This restriction enzyme "digests and adds a methyl group from Adenine": Type I Type II Type III DNase I Type III What increases the half-life of mRNA? 5' Methyl Cap 3' Methyl Cap Poly-A tail 5' Methionine Cap 5' Methyl Cap A parent has an autosomal dominant disorder. What percent chance does this parent have to pass down this affected gene to his/her child? 0% 25% 50% 75% 100% 50% The phrase "central dogma of molecular biology" refers to the flow of genetic data in this manner: DNA -- RNA -- Proteins DNA --Proteins -- Genes RNA -- DNA -- Proteins RNA -- Proteins -- DNA DNA -- RNA -- Proteins What drug is NOT metabolized by CYP2D6? Codeine Omeprazole Warfarin Escitalopram Warfarin You have sequenced a gene and observe the following: Reference: atgctggcacgacaggtttcccgactgg Sequenced: atgCctggcacgacaggtttcccgactgg The mutation observed is a: Frame-shift mutation Insertion Silent mutation Non-conservative mutation Frame-shift mutation