15 folds Study guides, Class notes & Summaries

Looking for the best study guides, study notes and summaries about 15 folds? On this page you'll find 2996 study documents about 15 folds.

Page 3 out of 2.996 results

Sort by

Pediatrics EOR Final Exam 2023 With All Questions and Answers
  • Pediatrics EOR Final Exam 2023 With All Questions and Answers

  • Exam (elaborations) • 52 pages • 2023
  • DERMATOLOGY (15%) DERMATITIS (DIAPER, PERIORAL) CANDIDAL DIAPER DERMATITIS • Beefy red plaques and satellite lesions involving the inguinal folds, perineum, buttocks • KOH prep of skin scarping to confirm • TOC: topical antifungal (Nystatin ointment)  “Azoles” (clotrimazole, miconazole, ketoconazole) IRRITANT DIAPER DERMATITIS • Usually do not involve the inguinal folds • 1% hydrocortisone ointment • Zinc oxide ointment as a barrier cream • Mupirocin ointment used...
    (0)
  • $14.99
  • + learn more
Department of Life and Consumer Sciences Molecular Genetics
  • Department of Life and Consumer Sciences Molecular Genetics

  • Exam (elaborations) • 5 pages • 2022
  • Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...
    (1)
  • $11.99
  • 1x sold
  • + learn more
BIOD 151 MODULE 2 EXAM QUESTIONS AND VERIFIED ANSWERS 2024 LATEST GUIDE.
  • BIOD 151 MODULE 2 EXAM QUESTIONS AND VERIFIED ANSWERS 2024 LATEST GUIDE.

  • Exam (elaborations) • 14 pages • 2024
  • BIOD 151 MODULE 2 EXAM QUESTIONS AND VERIFIED ANSWERS 2024 LATEST GUIDE. 2 / 7 1. True or false. The lungs are symmetrical.: False 2. Hilum: the "root" of the lung 3. healthy lung tissue is what color: peachy/pink color 4. pleurae: membranes that surround the lungs and the cavity around the lungs 5. visceral pleura: layer of pleura that faces/covers the lung 6. parietal pleura: outer layer of pleura lying closer to the ribs and chest wall thatcovers the surface around the lungs 7. p...
    (0)
  • $10.49
  • + learn more
Pediatric HESI BS Exam Questions with 100% Correct Answers | Updated | Download to score A+
  • Pediatric HESI BS Exam Questions with 100% Correct Answers | Updated | Download to score A+

  • Exam (elaborations) • 25 pages • 2024
  • Available in package deal
  • 1. A 10 year old boy is admitted to the ED. He is unresponsive and his laboratory values include a blood sugar of 800, potassium of 5, and arterial blood gas of pH 7.30, HCO3 15, PaC02 37. Which intervention has the highest priority? Administer IV of normal saline and insulin Frequently assess the child's respiratory effort Maintain strict intake and output records Give subq regular insulin by protocol ANS Administer IV of normal saline and insulin 2. What snack is best to provide a 6 year ...
    (0)
  • $14.49
  • + learn more
(Answered corrcetly) NR509 Final Exam Solution Guide 2022.
  • (Answered corrcetly) NR509 Final Exam Solution Guide 2022.

  • Exam (elaborations) • 13 pages • 2022
  • NR509 Final Exam Solution Guide 2022. A 35-year-old female with a history of migraines presents to the clinic with worsening symptoms for the past few weeks. She reports waking up at night with headaches and nausea. Her only medication history is oral contraceptive pills (OCPs). Otherwise, she states she is healthy. Which of the following actions if taken by the NP is the best next step? A grandmother is accompanying her 9-year-old granddaughter during a routine physical examination. She ...
    (2)
  • $15.49
  • 12x sold
  • + learn more
NRNP 6541 MIDTERM EXAM 1 VERSION 1 (V1) – QUESTION AND ANSWERS
  • NRNP 6541 MIDTERM EXAM 1 VERSION 1 (V1) – QUESTION AND ANSWERS

  • Exam (elaborations) • 25 pages • 2022
  • NRNP 6541 MIDTERM EXAM 1 VERSION 1 (V1) – QUESTION AND ANSWERS • Question 1 0 out of 0 points When completing this quiz, did you comply with Walden University’s Code of Conduct including the expectations for academic integrity? Selected Ye Answer: s • Question 2 1 out of 1 points Which of the following statements regarding adolescent substance use is true? Selected a. Answer: Tobacco is the most commonly abused substance during adolescence. •...
    (1)
  • $18.49
  • 1x sold
  • + learn more
First Assistant Study Guide Correct 100%
  • First Assistant Study Guide Correct 100%

  • Exam (elaborations) • 39 pages • 2024
  • Lymph channels run parallel to which structures? A. Nerves B. Veins C. Arteries D. Ligaments - ANSWER B. Veins Body temperature is regulated by the: A. Pons B. Cerebellum C. Midbrain D. Hypothalamus - ANSWER D. Hypothalamus Which two electrolytes are essential for normal cardiac contractions? A. Phosphate and chloride B. Magnesium and sodium C. Bicarbonate and sulfate D. Potassium and calcium - ANSWER D. Potassium and calcium Water constitutes what average normal percentage ...
    (0)
  • $13.99
  • + learn more
2022/2023 AANP Complete Review 2-2 Study Guide for Brand New Questions
  • 2022/2023 AANP Complete Review 2-2 Study Guide for Brand New Questions

  • Exam (elaborations) • 119 pages • 2023
  • AANP 2022/2023 Complete Review 2-2 Study Guide for Brand New Questions Dermatology Descriptor words are the most words, do not focus on the location that will help you the most. Acne Rosacea “N95 Acne” • Acne around the nose and mouth, pimples are small and cause discoloration of the skin. • Treat with topical metronidazole gel, topical sulfa drugs. Scabies • mites, they burrows they will have a linear lesion, serfientine lesions, it is not an infection. Treat with Promethe...
    (1)
  • $17.99
  • 1x sold
  • + learn more
ANCC IQ Domains 1-5 Qbank answered all correctly answered; latest updated summer 2023-2024. ANCC IQ Domains 1-5 Qbank answered all correctly answered; latest updated summer 2023-2024.
  • ANCC IQ Domains 1-5 Qbank answered all correctly answered; latest updated summer 2023-2024.

  • Other • 81 pages • 2022
  • ANCC IQ Domain • Domain 1: Scientific Foundation (40 questions with rationales) • Domain 2: Advanced Practice Skills (49 questions with rationales) • Domain 3: Diagnosis and Treatment (52 questions with rationales) • Domain 4: Psychotherapy and Related Theories (30 questions with rationales) • Domain 5: Ethical and Legal Principles (72 questions with rationales) ANCC Domain 1: Scientific Foundation (40 questions with rationales) As a PMHNP, you are aware of antipsychotic medic...
    (7)
  • $19.99
  • 35x sold
  • + learn more
Barkley Acute Care Nurse Practitioner Certification Exam 172 Q & A Review Question Bank Latest 2023/2024
  • Barkley Acute Care Nurse Practitioner Certification Exam 172 Q & A Review Question Bank Latest 2023/2024

  • Exam (elaborations) • 48 pages • 2023
  • Barkley Acute Care Nurse Practitioner Certification Exam 172 Q & A Review Question Bank 1. A 59-year-old is having a follow-up evaluation two years after the successful conclusion of radiation therapy for leukemia. He tells you that he has been feeling run-down and reports unexplained weight loss and night sweats. Upon examination, you determine that he also has a fever and pain below his ribs and the left side. You know that he is at risk for chronic lymphotic leukemia. Which of the fo...
    (0)
  • $17.99
  • 2x sold
  • + learn more