Page 1
Population Genetics
✽ Basic General Definitions:
- Species – a group of living organisms consisting of similar individuals
- Population – a group of individuals belonging to the same species that live in a defined
geographic area and actually or potentially interbreed
- Gene pool – total of all alleles possessed by the reproductive members of a population
- Speciation – the process by which new species arise
- Micro-evolution – evolutionary change within populations of a species
- Macro-evolution – evolutionary events leading to the emergence of new species
- Phylogenetics – the study of evolutionary history and relationships among individuals or
groups of organisms
Introduction to Population Genetics:
• Population genetics is the study of genetic diversity:
- Examines frequencies and distribution of genetic variation (alleles, genotypes and haplotypes)
- Used for studying genetic variation within and between populations and species
- Used to study forces that produce, maintain and eliminate genetic variation in health and disease
- Used to study how genetic variation changes through time and space
- Brings together molecular genetics, genomics, statistics, and mathematical models
Why Study Population Genetics?
- Evolution
- Conservation
- Epidemiology
- Tracing the origin of an outbreak
- Tracking how a pathogen evolves over the course of an epidemic
- Identifying drug resistance in mutations
- Demography
- The composition of a particular human population
- Human disease
, Page 2
Types of Genetic Variation:
- Single base change (SNP)
- Insertions and deletions (indel)
- Copy number variation (change in number of repeat units, or number of copies of a gene) (CNV)
- Large scale change (i.e. large section of a chromosome affected)
↳ All of the above can be further described according to:
- Frequency (rare vs polymorphism)
- Effects of amino acids (silent, synonymous, non-synonymous, missense, nonsense,
frameshift)
- Effects of natural selection on the variant (deleterious, beneficial, neutral)
• Types of Mutations:
- Silent – nucleotide substitution without a subsequent change in the amino acid
- Missense – point mutation that results in a codon that codes for a different amino acid
- Nonsense – point mutation that results in a premature stop codon
- Frameshift – indels that cause the entire downstream amino acid sequence to change
➢ SNPs cannot cause frameshift mutations
• What effect do these mutations have on the protein?
Mutation type DNA sequence RNA sequence Amino acid
Original ACA UGU Cysteine
Silent
ACG UGC Cysteine
(no change in amino acid)
Missense
ACC UGG Tryptophan
(change in amino acid)
Nonsense
(changes amino acid to ACT UGA Stop codon
stop codon)
Frameshift
(change in amino acid caused AACA UUGU Leucine (UUG)
by insertions or deletions)
, Page 3
Single Nucleotide Polymorphisms (SNPs):
AAATTTTCCCCGGGGGTTTTGGGGGCCC
AAATATTCCCCGGGGGTTTTGGGGGCCC
✓ Point mutation
✓ Substitution
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense or silent mutation
✓ Single nucleotide polymorphism (SNP)
✓ Single nucleotide variant (SNV)
Indels:
AAATTTTCCCCGGGGGTTTTGGGGGCCC
AAAGGGTTTTCCCCGGGGGTTTTGGGGGCCC
✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense, silent or frameshift mutation
✗ Point mutation
✗ Substitution
✗ SNP
Copy Number Variations (CNVs):
A A A ( T G C T G C T G C T G C ) A A C C C C G G G G G T T T T ( T G C (x4))
A A A T G C T G C T G C T G C T G C T G C A A C C C C G G G G G T T T T ( T G C (x6))
✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Change in number of repeats / copy number
✓ Changes the protein ➞ either missense, nonsense or silent mutation
✓ Copy number variant (CNV)
✗ SNP
, Page 4
Alleles:
- Diploid organisms have two copies of each gene
- Copies of genes may be different from each other due to a mutation
- Variant forms of the same genes are called alleles
- Definition: alternative form of a gene located at a specific position on a specific chromosome
➢Can be many alleles in a population, but only two alleles can exist in a single diploid organism
i.e. three alleles for this gene in a population:
Allele Nomenclature:
- Wild-type allele: allele associated with normal or most common phenotype (wt or +)
- Major allele: the frequent / most common allele
- Minor allele: a less frequent allele
- Genotype: combination of two alleles in a diploid organism
- Homozygous: genotype when the two alleles are identical
- Heterozygous: genotype when the two alleles are different from each other
- A*01, A*02, A*03: three different alleles of gene A
- A*01 / A*01: homozygous genotype
- A*01 / A*02: heterozygous genotype
Population Genetics
✽ Basic General Definitions:
- Species – a group of living organisms consisting of similar individuals
- Population – a group of individuals belonging to the same species that live in a defined
geographic area and actually or potentially interbreed
- Gene pool – total of all alleles possessed by the reproductive members of a population
- Speciation – the process by which new species arise
- Micro-evolution – evolutionary change within populations of a species
- Macro-evolution – evolutionary events leading to the emergence of new species
- Phylogenetics – the study of evolutionary history and relationships among individuals or
groups of organisms
Introduction to Population Genetics:
• Population genetics is the study of genetic diversity:
- Examines frequencies and distribution of genetic variation (alleles, genotypes and haplotypes)
- Used for studying genetic variation within and between populations and species
- Used to study forces that produce, maintain and eliminate genetic variation in health and disease
- Used to study how genetic variation changes through time and space
- Brings together molecular genetics, genomics, statistics, and mathematical models
Why Study Population Genetics?
- Evolution
- Conservation
- Epidemiology
- Tracing the origin of an outbreak
- Tracking how a pathogen evolves over the course of an epidemic
- Identifying drug resistance in mutations
- Demography
- The composition of a particular human population
- Human disease
, Page 2
Types of Genetic Variation:
- Single base change (SNP)
- Insertions and deletions (indel)
- Copy number variation (change in number of repeat units, or number of copies of a gene) (CNV)
- Large scale change (i.e. large section of a chromosome affected)
↳ All of the above can be further described according to:
- Frequency (rare vs polymorphism)
- Effects of amino acids (silent, synonymous, non-synonymous, missense, nonsense,
frameshift)
- Effects of natural selection on the variant (deleterious, beneficial, neutral)
• Types of Mutations:
- Silent – nucleotide substitution without a subsequent change in the amino acid
- Missense – point mutation that results in a codon that codes for a different amino acid
- Nonsense – point mutation that results in a premature stop codon
- Frameshift – indels that cause the entire downstream amino acid sequence to change
➢ SNPs cannot cause frameshift mutations
• What effect do these mutations have on the protein?
Mutation type DNA sequence RNA sequence Amino acid
Original ACA UGU Cysteine
Silent
ACG UGC Cysteine
(no change in amino acid)
Missense
ACC UGG Tryptophan
(change in amino acid)
Nonsense
(changes amino acid to ACT UGA Stop codon
stop codon)
Frameshift
(change in amino acid caused AACA UUGU Leucine (UUG)
by insertions or deletions)
, Page 3
Single Nucleotide Polymorphisms (SNPs):
AAATTTTCCCCGGGGGTTTTGGGGGCCC
AAATATTCCCCGGGGGTTTTGGGGGCCC
✓ Point mutation
✓ Substitution
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense or silent mutation
✓ Single nucleotide polymorphism (SNP)
✓ Single nucleotide variant (SNV)
Indels:
AAATTTTCCCCGGGGGTTTTGGGGGCCC
AAAGGGTTTTCCCCGGGGGTTTTGGGGGCCC
✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense, silent or frameshift mutation
✗ Point mutation
✗ Substitution
✗ SNP
Copy Number Variations (CNVs):
A A A ( T G C T G C T G C T G C ) A A C C C C G G G G G T T T T ( T G C (x4))
A A A T G C T G C T G C T G C T G C T G C A A C C C C G G G G G T T T T ( T G C (x6))
✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Change in number of repeats / copy number
✓ Changes the protein ➞ either missense, nonsense or silent mutation
✓ Copy number variant (CNV)
✗ SNP
, Page 4
Alleles:
- Diploid organisms have two copies of each gene
- Copies of genes may be different from each other due to a mutation
- Variant forms of the same genes are called alleles
- Definition: alternative form of a gene located at a specific position on a specific chromosome
➢Can be many alleles in a population, but only two alleles can exist in a single diploid organism
i.e. three alleles for this gene in a population:
Allele Nomenclature:
- Wild-type allele: allele associated with normal or most common phenotype (wt or +)
- Major allele: the frequent / most common allele
- Minor allele: a less frequent allele
- Genotype: combination of two alleles in a diploid organism
- Homozygous: genotype when the two alleles are identical
- Heterozygous: genotype when the two alleles are different from each other
- A*01, A*02, A*03: three different alleles of gene A
- A*01 / A*01: homozygous genotype
- A*01 / A*02: heterozygous genotype
