Written by students who passed Immediately available after payment Read online or as PDF Wrong document? Swap it for free 4,6 TrustPilot
logo-home
Class notes

Population Genetics

Rating
-
Sold
-
Pages
229
Uploaded on
07-03-2021
Written in
2020/2021

Detailed, in depth summary notes for Population Genetics (Genetics and Developmental Biology). The notes include explanations and definitions, as well as relevant diagrams and calculations.

Content preview

Page 1
Population Genetics


✽ Basic General Definitions:

- Species – a group of living organisms consisting of similar individuals
- Population – a group of individuals belonging to the same species that live in a defined
geographic area and actually or potentially interbreed

- Gene pool – total of all alleles possessed by the reproductive members of a population
- Speciation – the process by which new species arise
- Micro-evolution – evolutionary change within populations of a species
- Macro-evolution – evolutionary events leading to the emergence of new species
- Phylogenetics – the study of evolutionary history and relationships among individuals or
groups of organisms



Introduction to Population Genetics:

• Population genetics is the study of genetic diversity:
- Examines frequencies and distribution of genetic variation (alleles, genotypes and haplotypes)
- Used for studying genetic variation within and between populations and species
- Used to study forces that produce, maintain and eliminate genetic variation in health and disease
- Used to study how genetic variation changes through time and space
- Brings together molecular genetics, genomics, statistics, and mathematical models


Why Study Population Genetics?

- Evolution
- Conservation
- Epidemiology
- Tracing the origin of an outbreak
- Tracking how a pathogen evolves over the course of an epidemic
- Identifying drug resistance in mutations
- Demography
- The composition of a particular human population
- Human disease

, Page 2
Types of Genetic Variation:

- Single base change (SNP)
- Insertions and deletions (indel)
- Copy number variation (change in number of repeat units, or number of copies of a gene) (CNV)
- Large scale change (i.e. large section of a chromosome affected)

↳ All of the above can be further described according to:

- Frequency (rare vs polymorphism)
- Effects of amino acids (silent, synonymous, non-synonymous, missense, nonsense,
frameshift)

- Effects of natural selection on the variant (deleterious, beneficial, neutral)



• Types of Mutations:

- Silent – nucleotide substitution without a subsequent change in the amino acid
- Missense – point mutation that results in a codon that codes for a different amino acid
- Nonsense – point mutation that results in a premature stop codon
- Frameshift – indels that cause the entire downstream amino acid sequence to change
➢ SNPs cannot cause frameshift mutations



• What effect do these mutations have on the protein?

Mutation type DNA sequence RNA sequence Amino acid


Original ACA UGU Cysteine

Silent
ACG UGC Cysteine
(no change in amino acid)

Missense
ACC UGG Tryptophan
(change in amino acid)

Nonsense
(changes amino acid to ACT UGA Stop codon
stop codon)

Frameshift
(change in amino acid caused AACA UUGU Leucine (UUG)
by insertions or deletions)

, Page 3
Single Nucleotide Polymorphisms (SNPs):

AAATTTTCCCCGGGGGTTTTGGGGGCCC

AAATATTCCCCGGGGGTTTTGGGGGCCC


✓ Point mutation
✓ Substitution
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense or silent mutation
✓ Single nucleotide polymorphism (SNP)
✓ Single nucleotide variant (SNV)


Indels:

AAATTTTCCCCGGGGGTTTTGGGGGCCC

AAAGGGTTTTCCCCGGGGGTTTTGGGGGCCC


✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Changes the amino acid ➞ either missense, nonsense, silent or frameshift mutation

✗ Point mutation
✗ Substitution
✗ SNP


Copy Number Variations (CNVs):

A A A ( T G C T G C T G C T G C ) A A C C C C G G G G G T T T T ( T G C (x4))

A A A T G C T G C T G C T G C T G C T G C A A C C C C G G G G G T T T T ( T G C (x6))


✓ Mutation
✓ Change in length ➞ insertion or deletion (indel)
✓ Either polymorphism or rare variant ➞ depends on frequency in population (> or <1%)
✓ Change in number of repeats / copy number
✓ Changes the protein ➞ either missense, nonsense or silent mutation
✓ Copy number variant (CNV)

✗ SNP

, Page 4
Alleles:

- Diploid organisms have two copies of each gene
- Copies of genes may be different from each other due to a mutation
- Variant forms of the same genes are called alleles

- Definition: alternative form of a gene located at a specific position on a specific chromosome

➢Can be many alleles in a population, but only two alleles can exist in a single diploid organism



i.e. three alleles for this gene in a population:




Allele Nomenclature:

- Wild-type allele: allele associated with normal or most common phenotype (wt or +)
- Major allele: the frequent / most common allele
- Minor allele: a less frequent allele

- Genotype: combination of two alleles in a diploid organism
- Homozygous: genotype when the two alleles are identical
- Heterozygous: genotype when the two alleles are different from each other

- A*01, A*02, A*03: three different alleles of gene A

- A*01 / A*01: homozygous genotype
- A*01 / A*02: heterozygous genotype

Document information

Uploaded on
March 7, 2021
Number of pages
229
Written in
2020/2021
Type
Class notes
Professor(s)
Dr de assis rosa
Contains
All classes

Subjects

R100,00
Get access to the full document:

Wrong document? Swap it for free Within 14 days of purchase and before downloading, you can choose a different document. You can simply spend the amount again.
Written by students who passed
Immediately available after payment
Read online or as PDF


Document also available in package deal

Thumbnail
Package deal
Genetics and Developmental Biology Notes
-
4 2021
R 400,00 More info

Get to know the seller

Seller avatar
Reputation scores are based on the amount of documents a seller has sold for a fee and the reviews they have received for those documents. There are three levels: Bronze, Silver and Gold. The better the reputation, the more your can rely on the quality of the sellers work.
emmastein University of the Witwatersrand
View profile
Follow You need to be logged in order to follow users or courses
Sold
132
Member since
6 year
Number of followers
119
Documents
1
Last sold
1 month ago

4,2

35 reviews

5
17
4
11
3
4
2
2
1
1

Trending documents

Recently viewed by you

Why students choose Stuvia

Created by fellow students, verified by reviews

Quality you can trust: written by students who passed their exams and reviewed by others who've used these notes.

Didn't get what you expected? Choose another document

No worries! You can immediately select a different document that better matches what you need.

Pay how you prefer, start learning right away

No subscription, no commitments. Pay the way you're used to via credit card or EFT and download your PDF document instantly.

Student with book image

“Bought, downloaded, and aced it. It really can be that simple.”

Alisha Student

Frequently asked questions