Page 1 of 7
BIOLOGY 210 EXAM 1 (CH. 1-5) PRACTICE
QUESTIONS AND VERIFIED ANSWERS
Terms in this set (34) Q & A
>> The valence electron shell of an atom is ________?
-answer- The outer most electron shell
>> In non polar amino acids, which part of the protein would you begin looking for members
of this class of amino acids in a protein formed in the cell cytoplasm?
-answer- On the interior of the proton
>> If an atom has 5 valence electrons, how many covalent bonds can it make?
-answer- Three
>> Which functional group is potentially positively charged?
-answer- Amine
>> A hydrogen atom has only one shell in its valence shell. How many covalent bonds can it
form?
-answer- One
, Page 2 of 7
>> The monomer found in the polysaccharides starch, glycogen and cellulose is a __________.
-answer- Monosaccharide called glucose
>> For the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAGUCCAUCCAGUU
CUGCUUCUUUU What nucleic acid is represented here?
-answer- RNA sequence
>> What kinds of bonds stabilize the protein tertiary structure? 1.) ionic bonds 2.) covalent
bonds 3.) hydrogen bonds 4.) all three kinds of bonds
-answer- All three kinds of bonds
>> If an atom has an atomic number of 8 and an atomic mass of 16. How many neutrons are
in the nucleus?
-answer- Eight
>> The chemical reaction by which water is added to a covalent bond connecting two
monomers that breaks the connecting bonds and makes them separate monomers is called?
-answer- Hydrolysis reaction
>> Nitrogen has a valence of 3. How many covalent bonds can a nitrogen atom form with
other atoms?
-answer- Three
BIOLOGY 210 EXAM 1 (CH. 1-5) PRACTICE
QUESTIONS AND VERIFIED ANSWERS
Terms in this set (34) Q & A
>> The valence electron shell of an atom is ________?
-answer- The outer most electron shell
>> In non polar amino acids, which part of the protein would you begin looking for members
of this class of amino acids in a protein formed in the cell cytoplasm?
-answer- On the interior of the proton
>> If an atom has 5 valence electrons, how many covalent bonds can it make?
-answer- Three
>> Which functional group is potentially positively charged?
-answer- Amine
>> A hydrogen atom has only one shell in its valence shell. How many covalent bonds can it
form?
-answer- One
, Page 2 of 7
>> The monomer found in the polysaccharides starch, glycogen and cellulose is a __________.
-answer- Monosaccharide called glucose
>> For the nucleotide sequence,
UUAGCUUCCUUCUCCGUCCAAGACAGCAGCAGCCAGUCACAGACCAGGAUGAAGUCCAUCCAGUU
CUGCUUCUUUU What nucleic acid is represented here?
-answer- RNA sequence
>> What kinds of bonds stabilize the protein tertiary structure? 1.) ionic bonds 2.) covalent
bonds 3.) hydrogen bonds 4.) all three kinds of bonds
-answer- All three kinds of bonds
>> If an atom has an atomic number of 8 and an atomic mass of 16. How many neutrons are
in the nucleus?
-answer- Eight
>> The chemical reaction by which water is added to a covalent bond connecting two
monomers that breaks the connecting bonds and makes them separate monomers is called?
-answer- Hydrolysis reaction
>> Nitrogen has a valence of 3. How many covalent bonds can a nitrogen atom form with
other atoms?
-answer- Three
