Escrito por estudiantes que aprobaron Inmediatamente disponible después del pago Leer en línea o como PDF ¿Documento equivocado? Cámbialo gratis 4,6 TrustPilot
logo-home
Document preview thumbnail
Vista previa 4 fuera de 38 páginas
Examen

Cell & Molecular Biology (BIOL 300) Actual Exam 2 Notes to Pass Your Exam (2025–2026) | Virginia Commonwealth University

Document preview thumbnail
Vista previa 4 fuera de 38 páginas

Thorough and exam-focused notes for BIOL 300 (Cell & Molecular Biology) Exam 2 at Virginia Commonwealth University. Topics include the central dogma of molecular biology, DNA structure and base pairing, chromosomes and chromatin organization, replication, nucleosomes, histones, chromatin remodeling, epigenetics, and visualizing DNA through FISH and staining. Clearly structured with diagrams and examples to support deep understanding and high exam performance.

Vista previa del contenido

CELL & MOLECULAR BIOLOGY (BIOL 300)
ACTUAL EXAM 2 NOTES TO PASS YOUR
EXAM (2025-2026) VIRGINIA
COMMONWEALTH UNIVERSITY

,Exam 2:
DNA and Chromosomes
A. The central dogma of molecular biology ‘The flow of genetic material’
a. DNA
i. Information storage “the hard Drive”
ii. DNA synthesis r5
1. Replication
b. RNA
i. Temporary message “the cache”
ii. RNA synthesis
1. Transcription
c. Protein
i. Functional units “the programs”
ii. Protein synthesis
1. Translation
B. The instructions for life
a. Deoxyribonucleic acid (DNA)
i. Recognized in 1940’s as likely carrier genetic information
ii. Structure determined in 1953 by Watson and Crick with the help of
Rosalind Franklin and Charagaffnn
iii. DNA is polymer
b. Nucleotides: building blocks of DNA
i. Nucleotides covalently linked by phosphodiester linkage to form
polynucleotide chains (DNA strands)
1. Repeating: sugar-phosphate-sugar-phosphate
a. G= Guanine
b. A= Adenine
c. C=Cytosine
d. T=Thymine
ii. The structure of DNA:
https://www.youtube.com/watch?v=o_-6JXLYS-k
iii. Building blocks of DNA
1. Sugar-phosphate covalently linked to a base
c. Complementary base pairings
i. Held together by hydrogen bonds between paired bases
1. Always paired together
a. A-T (adenine-thymine)
b. G-C (guanine-cytosine)
ii. DNA strands run antiparallel
1. 5’ phosphate

, 2. 3’ hydroxyl
iii. Complementary base pairing
d. Hydrogen bonds between strands
i. Between A&T: 2 bonds
1. Tata boxes are made of A&Ts. They're easy to break because the
only have 2 hydrogen bond
ii. Between G&C: 3 bonds
iii. ONLY fits if strands run ANTIparallel (One strand 5’ to 3’ and the other
3’ to 5’)
e. Twisted helix
i. Right- handed helix
ii. 10 base pairs per helical turn
iii. Major groove- wider
1. More action
iv. Minor groove- smaller
1. Less action
f. Complement
i. What is the complement?
1. 5’ ATTGCATCGTGTGCAATCGTATC 3’
2. 3’ TAACGTAGCACACGTTAGCATAG 5’
a. If you know what one strand looks like you will know the
other
b. C to G and A to T; allows each strands to be copied during
replication
C. Chromosomes: how the data is stored
a. Bacteria
i. Single, circular DNA molecule
b. Eukaryotic cells
i. Long double stranded DNA packaged into chromosomes
1. Chromosomes are linear
c. Human cell contains 2 m (6ft) of DNA but the cell nucleus is 5-8 𝛍m in diameter
D. Eukaryotic (Human) DNA
a. Human genome
i. 3.2*10^9 (billion) nucleotides on 23 pairs of chromosomes
1. 22 autosomes and one pair of sex chromosomes
b. Each cell has 46 single chromosomes
c. Each chromosome is a single, long DNA molecule
d. 2 similar copies of each chromosome
i. Homologous chromosomes
1. Homologs: same genes, different alleles

, 2. 22 pairs in each cell
ii. Chroma (greek)= color
e. Non Homologous pair
i. Sex chromosomes XX or XY girl XX boy XY
1. One pair in each cell
E. Chromosomes contain our genes
a. The functional units of heredity
i. What is a gene?: https://www.youtube.com/watch?v=5MQdXjRPHmQ
1. What is a gene?
a. A special stretch of DNA: a sequence of A,C,T,G’s that
codes for something
b. Contains information for a cell to read
2. What do those codes do
a. Genes make protein, that build things
3. Size matters ( °͡ ʖ͜ °͡)
a. Genes can range from 300- million letters long
b. The length and sequence of a gene determine the size and
shape of the protein it builds.
c. That size and shape of protein determines the function that
protein will have.
4. Many creatures share the same genes
a. Humans and chimps share over 96% of their genetic code
5. All genes are written in the same basic DNA language
a. A,C,T, and G’s
ii. Intragenic* means DNA between the genes or “junk DNA”
b. Region of DNA, responsible for specifying a single protein or RNA molecule
c. Also contains large regions of noncoding DNA
i. Often referred to as “junk DNA”
1. Now known to be involved in the regulation of our genes
d. The organization of genes on a human chromosome
i. Grey regions are the intragenic




ii.

Información del documento

Subido en
23 de julio de 2025
Número de páginas
38
Escrito en
2024/2025
Tipo
Examen
Contiene
Preguntas y respuestas
$19.49

¿Documento equivocado? Cámbialo gratis Dentro de los 14 días posteriores a la compra y antes de descargarlo, puedes elegir otro documento. Puedes gastar el importe de nuevo.
Escrito por estudiantes que aprobaron
Inmediatamente disponible después del pago
Leer en línea o como PDF

Seller avatar
Los indicadores de reputación están sujetos a la cantidad de artículos vendidos por una tarifa y las reseñas que ha recibido por esos documentos. Hay tres niveles: Bronce, Plata y Oro. Cuanto mayor reputación, más podrás confiar en la calidad del trabajo del vendedor.
saraciousstuvia
4.0
(118)
Vendido
572
Seguidores
380
Artículos
11322
Última venta
1 mes hace




Por qué los estudiantes eligen Stuvia

Creado por compañeros estudiantes, verificado por reseñas

Calidad en la que puedes confiar: escrito por estudiantes que aprobaron y evaluado por otros que han usado estos resúmenes.

¿No estás satisfecho? Elige otro documento

¡No te preocupes! Puedes elegir directamente otro documento que se ajuste mejor a lo que buscas.

Paga como quieras, empieza a estudiar al instante

Sin suscripción, sin compromisos. Paga como estés acostumbrado con tarjeta de crédito y descarga tu documento PDF inmediatamente.

Student with book image

“Comprado, descargado y aprobado. Así de fácil puede ser.”

Alisha Student

Preguntas frecuentes