Recitation #8: Nucleic Acid Methods and Bioinformatics
Nucleic Acid Methods questions:
1. The plasmid pBR322 is shown below. There are two antibiotic resistance genes
in pBR322, conferring resistance to ampicillin (amp) and tetracycline (tet). The
plasmid contains several unique restriction sites, including the PstI site within
the amp region. If the gene for a protein of interest is cloned into the PstI site of
pBR322, describe how one could select for E. coli carrying the recombinant
plasmid.
E. coli that have not been transformed by pBR322 cannot grow in the presence of either
ampicillin or tetracycline, whereas transformation by the pBR322 plasmid confers
resistance to both antibiotics. However, a foreign DNA insert in pBR322’s PstI site
disrupts its amp gene. Hence, E. coli that had been transformed by pBR322 containing a
foreign DNA insert in its PstI site can grow in the presence of tetracycline, but not in the
presence of ampicillin. Thus, such E. coli can be selected by first growing bacterial
colonies on agar plates containing tetracycline and then, through replica plating,
transferring them to ampicillin-containing agar plates. Only those colonies that grow on
tetracycline-containing plates but fail to grow on ampicillin-containing plates contain the
requisite bacteria.
Figure: https://en.wikipedia.org/wiki/PBR322
2. The region of the pBR322 plasmid
containing the PstI restriction site
(CTGCAG) has the sequence:
5′CGCCAGTTAA TAGTTTGCGC AACGTTGTTG
CCATTGCTGC AGGCATCGTG GTGTCACGCT-3′
Design a 26-base oligonucleotide that could
be used to change the PstI site to an XhoI
site (CTCGAG) via site-directed
mutagenesis.
A 26-base oligonucleotide used to make this
change via site-directed mutagenesis must be
complementary to the sequence encoding the mutant protein and should be centered over
the mutation site to maximize the binding affinity of the oligonucleotide for the DNA
(generally we would use longer oligonucleotides to increase binding affinity). The
sequence of one of the required oligonucleotides is: 5′GTTGCCATTGCTCGAGGCATCGTGGT
3′ (The oligonucleotide for the other strand would be complementary to this one). The
mismatched bases are shown in blue with 12 complementary bases on each side.
, 3. Indicate the sequences of the two 6-residue primers that could be used to
amplify the central 40-nucleotide region of the 60-nucleotide pBR322 sequence
in question #2.
5′CGCCAGTTAA TAGTTTGCGC AACGTTGTTG CCATTGCTGC AGGCATCGTG GTGTCACGCT-3′
5′-TAGTTT-3′ and 5′-CACGAT-3′
Bioinformatics Questions:
4. Phospholipase A2 is an enzyme that cleaves membrane lipids, producing arachidonic
acid, a precursor for the prostaglandins that are involved in pain and inflammation. A
BLAST search of the phospholipase A2 sequence from saw scaled vipers identifies a
related protein in humans. Given the alignment below, calculate the % identities, the
alignment score (AS), and the normalized alignment score (NAS).
% identities = 100*40/((122+148)/2) = 29.6%
Alignment Score = 40 identities– 4 internal gaps = 400 -100 = 300
Normalized Alignment Score = 100*300/((122+148)/2) = 222
Nucleic Acid Methods questions:
1. The plasmid pBR322 is shown below. There are two antibiotic resistance genes
in pBR322, conferring resistance to ampicillin (amp) and tetracycline (tet). The
plasmid contains several unique restriction sites, including the PstI site within
the amp region. If the gene for a protein of interest is cloned into the PstI site of
pBR322, describe how one could select for E. coli carrying the recombinant
plasmid.
E. coli that have not been transformed by pBR322 cannot grow in the presence of either
ampicillin or tetracycline, whereas transformation by the pBR322 plasmid confers
resistance to both antibiotics. However, a foreign DNA insert in pBR322’s PstI site
disrupts its amp gene. Hence, E. coli that had been transformed by pBR322 containing a
foreign DNA insert in its PstI site can grow in the presence of tetracycline, but not in the
presence of ampicillin. Thus, such E. coli can be selected by first growing bacterial
colonies on agar plates containing tetracycline and then, through replica plating,
transferring them to ampicillin-containing agar plates. Only those colonies that grow on
tetracycline-containing plates but fail to grow on ampicillin-containing plates contain the
requisite bacteria.
Figure: https://en.wikipedia.org/wiki/PBR322
2. The region of the pBR322 plasmid
containing the PstI restriction site
(CTGCAG) has the sequence:
5′CGCCAGTTAA TAGTTTGCGC AACGTTGTTG
CCATTGCTGC AGGCATCGTG GTGTCACGCT-3′
Design a 26-base oligonucleotide that could
be used to change the PstI site to an XhoI
site (CTCGAG) via site-directed
mutagenesis.
A 26-base oligonucleotide used to make this
change via site-directed mutagenesis must be
complementary to the sequence encoding the mutant protein and should be centered over
the mutation site to maximize the binding affinity of the oligonucleotide for the DNA
(generally we would use longer oligonucleotides to increase binding affinity). The
sequence of one of the required oligonucleotides is: 5′GTTGCCATTGCTCGAGGCATCGTGGT
3′ (The oligonucleotide for the other strand would be complementary to this one). The
mismatched bases are shown in blue with 12 complementary bases on each side.
, 3. Indicate the sequences of the two 6-residue primers that could be used to
amplify the central 40-nucleotide region of the 60-nucleotide pBR322 sequence
in question #2.
5′CGCCAGTTAA TAGTTTGCGC AACGTTGTTG CCATTGCTGC AGGCATCGTG GTGTCACGCT-3′
5′-TAGTTT-3′ and 5′-CACGAT-3′
Bioinformatics Questions:
4. Phospholipase A2 is an enzyme that cleaves membrane lipids, producing arachidonic
acid, a precursor for the prostaglandins that are involved in pain and inflammation. A
BLAST search of the phospholipase A2 sequence from saw scaled vipers identifies a
related protein in humans. Given the alignment below, calculate the % identities, the
alignment score (AS), and the normalized alignment score (NAS).
% identities = 100*40/((122+148)/2) = 29.6%
Alignment Score = 40 identities– 4 internal gaps = 400 -100 = 300
Normalized Alignment Score = 100*300/((122+148)/2) = 222
