BIO 235 Final Exam Study Guide 2026/2027
| Complete Exam Prep & Review
The Central Dogma of molecular biology states that, in cells, biological
information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - correct answer-
B
What is the exception to the Central Dogma rule? - correct answer-
RETROVIRUSES (process goes from RNA to DNA using reverse transcriptase
enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - correct
answer-Reverse transcriptase enzymes
,What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - correct answer-D
Copy-and-paste transposons a.k.a. replicative transposition - correct answer-A
new copy of the transposable element is introduced at a new site while the old
copy remains behind at the original site (so the number of copies of the
transposable element increases)
Transposons a.k.a. transposable elements - correct answer-Sequences that can
move about in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - correct answer-NO
Are inverted repeats part of a transposon? - correct answer-YES
Transposition - correct answer-The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - correct answer-
Transposable element excises from the old site and inserts at a new site
WITHOUT any increase in the number of its copies
,Retrotransposons - correct answer-Elements that transpose through an RNA
intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA
molecules are called ________, whereas mutagenic compounds that cause the
covalent attachment of a methyl or an ethyl group to bases of DNA are called
______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - correct answer-C
Base analogs - correct answer-Chemicals with structures similar to that of any of
the four standard bases of DNA (DNA polymerase canNOT distinguish these
analogs from the standard bases)
Alkylating agents - correct answer-Chemicals that donate alkyl groups like methyl
and ethyl groups
Deamination - correct answer-Removing an amino group
Intercalating agents - correct answer-Produce mutations by sandwiching
themselves (intercalating) between adjacent bases in DNA, distorting the three-
dimensional structure of the helix and causing single-nucleotide insertions and
deletions in replication
, What form of radiation causes double-strand breaks in DNA? - correct answer-X-
rays (ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - correct
answer-UV rays
Pyrimidine dimers - correct answer-Formation of a chemical bond between
adjacent pyrimidine molecules on the same strand of DNA
Depurination - correct answer-The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - correct answer-D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of
proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the
formation of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
| Complete Exam Prep & Review
The Central Dogma of molecular biology states that, in cells, biological
information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - correct answer-
B
What is the exception to the Central Dogma rule? - correct answer-
RETROVIRUSES (process goes from RNA to DNA using reverse transcriptase
enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - correct
answer-Reverse transcriptase enzymes
,What category of transposable elements use an RNA copy of their genome in the
process of transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - correct answer-D
Copy-and-paste transposons a.k.a. replicative transposition - correct answer-A
new copy of the transposable element is introduced at a new site while the old
copy remains behind at the original site (so the number of copies of the
transposable element increases)
Transposons a.k.a. transposable elements - correct answer-Sequences that can
move about in the genome and are often a cause of mutations
Are direct repeats part of a transposon? - correct answer-NO
Are inverted repeats part of a transposon? - correct answer-YES
Transposition - correct answer-The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - correct answer-
Transposable element excises from the old site and inserts at a new site
WITHOUT any increase in the number of its copies
,Retrotransposons - correct answer-Elements that transpose through an RNA
intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA
molecules are called ________, whereas mutagenic compounds that cause the
covalent attachment of a methyl or an ethyl group to bases of DNA are called
______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - correct answer-C
Base analogs - correct answer-Chemicals with structures similar to that of any of
the four standard bases of DNA (DNA polymerase canNOT distinguish these
analogs from the standard bases)
Alkylating agents - correct answer-Chemicals that donate alkyl groups like methyl
and ethyl groups
Deamination - correct answer-Removing an amino group
Intercalating agents - correct answer-Produce mutations by sandwiching
themselves (intercalating) between adjacent bases in DNA, distorting the three-
dimensional structure of the helix and causing single-nucleotide insertions and
deletions in replication
, What form of radiation causes double-strand breaks in DNA? - correct answer-X-
rays (ionizing radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - correct
answer-UV rays
Pyrimidine dimers - correct answer-Formation of a chemical bond between
adjacent pyrimidine molecules on the same strand of DNA
Depurination - correct answer-The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
E. 7 - correct answer-D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of
proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the
formation of alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
