MIC 205 EXAM #2 QUESTIONS AND ANSWERS
Which of these factors do/does not affect enzyme activity? - Answers -Humiditiy
Which of the following statements is FALSE? Enzymes ___________ - Answers -
Convert coenzymes to products
Which of the following statements is TRUE? Enzymes _____ - Answers -Bind to
substrates
Lower the energy of activation
Speed up biochemical reactions
Can be named after the kinds of reactions they catalyze
Based on the name, NADH dehydrogenase is - Answers -An enzyme that oxidizes
NADH
What is the end product of glycolysis? - Answers -Pyruvate
The central metabolic pathway(s) is/are - Answers -Glycolysis, TCA cycle, and Pentose
Phosphate Pathway
Which of these pathways gives a cell the potential to produce the most ATP? - Answers
-TCA cycle
In fermentation, the terminal electron acceptor is - Answers -An organic compound
In the process of oxidative phosphorylation, the energy of a proton motive forced is
USED to generate - Answers -ATP
If a bacterium loses the ability to produce FADH2, which of the following cannot
continue? - Answers -TCA cycle
Degradation of fats as an energy source involves all of the following: - Answers -B-
oxidation, acetyl-coA, glycerol
(NOT transamination)
Check all statements that apply to the bacterial cytoplasmic membrane - Answers --
Aquaporins
-Barrier to large compounds
-Proton motive force
, The decimal reduction time is the time it takes to destroy 90% of a given bacterial
population under certain conditions. If 90% of a population of 10,000 bacteria dies in 5
minutes, how long would it take to reduce the population to 10 cells? - Answers -15
The codon 5' UGC 3' on mRNA encodes for cysteine. Which sequence represents an
anticodon from the 5' to 3' direction? - Answers -GCA
Chemoheterotrophs - Answers --Use preformed organic molecules as an energy
source
-Use preformed organic molecules as a carbon source
You placed a few corn seeds onto the surface of a growth medium in Petri dishes and
wait for them to germinate into seedlings. The medium contains sources of nitrogen,
phosphate, and a number of other macro- and micro-nutrients, but no carbon. After a
few weeks, you see a contaminant growing on your plates. Assuming the organism is
not digesting the agar itself, which of the following is most likely your contaminant? -
Answers --Photoautotrophic species of bacteria, archaea, or protists
Silent mutation - Answers --Change in DNA codon does not result in a change in AA
Frameshift mutation - Answers --Deletion or insertion of nucleotides not divisible by
three
Missense mutation - Answers --Change in DNA codon results in a change in amino
acid
Nonsense mutation - Answers --Sense codon is converted to a stop codon
If the mRNA, 5' GCUGAUGAUCCGCGUACGUGUUAGCA 3' is translated, what is the
codon that corresponds to the third amino acid in the resulting protein? - Answers -
CGC
Which of the following best describe enzymes? - Answers --Enzymes do not change
after a reaction
-Enzymes reduce activation energy
Order the following events in the oxidation of glucose - Answers -1. Phosphorylation of
glucose
2. Formation of pyruvate
3. Formation of acetyl-CoA
4. TCA cycle
5. Oxidative phosphorylation
What enzyme separates thymine dimers - Answers --Photolyases
Which of these factors do/does not affect enzyme activity? - Answers -Humiditiy
Which of the following statements is FALSE? Enzymes ___________ - Answers -
Convert coenzymes to products
Which of the following statements is TRUE? Enzymes _____ - Answers -Bind to
substrates
Lower the energy of activation
Speed up biochemical reactions
Can be named after the kinds of reactions they catalyze
Based on the name, NADH dehydrogenase is - Answers -An enzyme that oxidizes
NADH
What is the end product of glycolysis? - Answers -Pyruvate
The central metabolic pathway(s) is/are - Answers -Glycolysis, TCA cycle, and Pentose
Phosphate Pathway
Which of these pathways gives a cell the potential to produce the most ATP? - Answers
-TCA cycle
In fermentation, the terminal electron acceptor is - Answers -An organic compound
In the process of oxidative phosphorylation, the energy of a proton motive forced is
USED to generate - Answers -ATP
If a bacterium loses the ability to produce FADH2, which of the following cannot
continue? - Answers -TCA cycle
Degradation of fats as an energy source involves all of the following: - Answers -B-
oxidation, acetyl-coA, glycerol
(NOT transamination)
Check all statements that apply to the bacterial cytoplasmic membrane - Answers --
Aquaporins
-Barrier to large compounds
-Proton motive force
, The decimal reduction time is the time it takes to destroy 90% of a given bacterial
population under certain conditions. If 90% of a population of 10,000 bacteria dies in 5
minutes, how long would it take to reduce the population to 10 cells? - Answers -15
The codon 5' UGC 3' on mRNA encodes for cysteine. Which sequence represents an
anticodon from the 5' to 3' direction? - Answers -GCA
Chemoheterotrophs - Answers --Use preformed organic molecules as an energy
source
-Use preformed organic molecules as a carbon source
You placed a few corn seeds onto the surface of a growth medium in Petri dishes and
wait for them to germinate into seedlings. The medium contains sources of nitrogen,
phosphate, and a number of other macro- and micro-nutrients, but no carbon. After a
few weeks, you see a contaminant growing on your plates. Assuming the organism is
not digesting the agar itself, which of the following is most likely your contaminant? -
Answers --Photoautotrophic species of bacteria, archaea, or protists
Silent mutation - Answers --Change in DNA codon does not result in a change in AA
Frameshift mutation - Answers --Deletion or insertion of nucleotides not divisible by
three
Missense mutation - Answers --Change in DNA codon results in a change in amino
acid
Nonsense mutation - Answers --Sense codon is converted to a stop codon
If the mRNA, 5' GCUGAUGAUCCGCGUACGUGUUAGCA 3' is translated, what is the
codon that corresponds to the third amino acid in the resulting protein? - Answers -
CGC
Which of the following best describe enzymes? - Answers --Enzymes do not change
after a reaction
-Enzymes reduce activation energy
Order the following events in the oxidation of glucose - Answers -1. Phosphorylation of
glucose
2. Formation of pyruvate
3. Formation of acetyl-CoA
4. TCA cycle
5. Oxidative phosphorylation
What enzyme separates thymine dimers - Answers --Photolyases
