Questions and CORRECT Answers
What type of variable can have only one of two values - True or False? - CORRECT
ANSWER - Boolean
What does the expression True and not (False or False) return? - CORRECT ANSWER -
True
What does the expression True or ((not False) and False) return? - CORRECT ANSWER -
True
Which built-in Python data structure consists of a set of key-value pairs? - CORRECT
ANSWER - Dictionary
Let tea_party = ['March Hare', 'Hatter', 'Dormouse',
'Alice']
What is the value of tea_party[-1]? - CORRECT ANSWER - Alice
Compute PatternCount("AAA",
"GACCATCAAAACTGATAAACTACTTAAAAATCAGT"). - CORRECT ANSWER -6
What is the reverse complement of "GATTACA" ? - CORRECT ANSWER - TGTAATC
You are given the following Python code:
text="GATGCGGT"
for y in text[1:4]:
print(y)
What will be the output? - CORRECT ANSWER - ATG
, You are given the following Python code:
x=0
for y in range(0,5):
x += y
print(x)
What will be the output? - CORRECT ANSWER - 10
What is the most frequent 3-mer of
"CGGAGGACTCTAGGTAACGCTTATCAGGTCCATAGGACATTCA" ? - CORRECT
ANSWER - AGG
The position of the E. coli genome at which the skew attains a maximum
value is most likely near which of the following?
A. the origin of replication
B. the replication terminus
C. the middle of the forward strand
D. the middle of the reverse strand - CORRECT ANSWER -B
(extra credit) Identify the value of i for which the skew array of
"GATACACTTCCCGAGTAGGTACTG" attains a minimum value. Report the
position of the first occurrence only, with 1-based numeration with respect
to the Genome (i.e., Skew[1] corresponds to "G" here) - CORRECT ANSWER - -2
What does chip-seq do? - CORRECT ANSWER - etermines protein-binding sites on DNA
Given 100-nucleotide long strings X = ATGC....CATA and Y = TATG....CTTG
with Count(X, ATAT) = 20 and Count(Y, ATAT) = 12, what is Count(X+Y,