BIO 235 - Final Exam Study Guide Questions with Verified Solutions Graded A+
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - Answers B
What is the exception to the Central Dogma rule? - Answers RETROVIRUSES (process goes from
RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - Answers Reverse
transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the process of
transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - Answers D
Copy-and-paste transposons a.k.a. replicative transposition - Answers A new copy of the
transposable element is introduced at a new site while the old copy remains behind at the
original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements - Answers Sequences that can move about in the
genome and are often a cause of mutations
Are direct repeats part of a transposon? - Answers NO
Are inverted repeats part of a transposon? - Answers YES
Transposition - Answers The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - Answers Transposable element
excises from the old site and inserts at a new site WITHOUT any increase in the number of its
copies
,Retrotransposons - Answers Elements that transpose through an RNA intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules are called
________, whereas mutagenic compounds that cause the covalent attachment of a methyl or an
ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - Answers C
Base analogs - Answers Chemicals with structures similar to that of any of the four standard
bases of DNA (DNA polymerase canNOT distinguish these analogs from the standard bases)
Alkylating agents - Answers Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination - Answers Removing an amino group
Intercalating agents - Answers Produce mutations by sandwiching themselves (intercalating)
between adjacent bases in DNA, distorting the three-dimensional structure of the helix and
causing single-nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? - Answers X-rays (ionizing
radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - Answers UV rays
Pyrimidine dimers - Answers Formation of a chemical bond between adjacent pyrimidine
molecules on the same strand of DNA
Depurination - Answers The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
, E. 7 - Answers D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation of
alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in space -
Answers C
Primary structure of a protein - Answers Sequence of amino acids
Secondary structure of a protein - Answers Interactions between neighboring amino acids
causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet - regional
folding)
Tertiary structure of a protein - Answers Overall-three dimensional shape of the protein (when
secondary structures fold even further)
Quaternary structure - Answers When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may be able to
anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - Answers E (wobble takes place on the THIRD position of a codon and the
FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) - Answers 3' end (third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) - Answers 5' end (first
position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
The Central Dogma of molecular biology states that, in cells, biological information _______.
A. Can be transmitted either from DNA to RNA or from RNA to DNA
B. Moves from DNA to RNA to protein
C. Moves from protein to RNA to DNA
D. Moves from DNA to RNA only if encoded by certain viruses
E. Moves from protein to RNA only if encoded by certain viruses - Answers B
What is the exception to the Central Dogma rule? - Answers RETROVIRUSES (process goes from
RNA to DNA using reverse transcriptase enzymes)
What do retroviruses have that allows them to go from RNA to DNA? - Answers Reverse
transcriptase enzymes
What category of transposable elements use an RNA copy of their genome in the process of
transposition?
A. Cut-and-paste transposons
B. Composite bacterial transposons
C. Bacterial insertion sequences
D. Retrotransposons
E. Multiple drug resistance plasmids - Answers D
Copy-and-paste transposons a.k.a. replicative transposition - Answers A new copy of the
transposable element is introduced at a new site while the old copy remains behind at the
original site (so the number of copies of the transposable element increases)
Transposons a.k.a. transposable elements - Answers Sequences that can move about in the
genome and are often a cause of mutations
Are direct repeats part of a transposon? - Answers NO
Are inverted repeats part of a transposon? - Answers YES
Transposition - Answers The movement of a transposon
Cut-and-paste transposons a.k.a. nonreplicative transposition - Answers Transposable element
excises from the old site and inserts at a new site WITHOUT any increase in the number of its
copies
,Retrotransposons - Answers Elements that transpose through an RNA intermediate
Mutagenic compounds that fit and "get stuck" between nucleotides of DNA molecules are called
________, whereas mutagenic compounds that cause the covalent attachment of a methyl or an
ethyl group to bases of DNA are called ______.
A. De-aminating agents; reactive oxygen molecules
B. Oxidizing agents; glycosylases
C. Intercalating agents; alkylating agents
D. Hydrolases; base analogs
E. Catalytic converters; organic solvents - Answers C
Base analogs - Answers Chemicals with structures similar to that of any of the four standard
bases of DNA (DNA polymerase canNOT distinguish these analogs from the standard bases)
Alkylating agents - Answers Chemicals that donate alkyl groups like methyl and ethyl groups
Deamination - Answers Removing an amino group
Intercalating agents - Answers Produce mutations by sandwiching themselves (intercalating)
between adjacent bases in DNA, distorting the three-dimensional structure of the helix and
causing single-nucleotide insertions and deletions in replication
What form of radiation causes double-strand breaks in DNA? - Answers X-rays (ionizing
radiation)
What form of radiation forms pyrimidine dimers (or thymine dimers)? - Answers UV rays
Pyrimidine dimers - Answers Formation of a chemical bond between adjacent pyrimidine
molecules on the same strand of DNA
Depurination - Answers The loss of a purine base from a nucleotide
How many amino acids are encoded in the following RNA sequence?
5' - AUGCCUGAAUGGGCUUUAUGA - 3'
A. 3
B. 4
C. 5
D. 6
, E. 7 - Answers D (there is no amino acid for a stop codon)
What feature of the polypeptide chain determines the secondary structure of proteins?
A. The last carboxyl group
B. The first amino group
C. Intra-molecular hydrogen bonding among amino acid units that induces the formation of
alpha-helices and beta-pleated-sheets
D. Interactions among the components of multi-protein complex
E. The hinge regions that allow the alpha-helices and beta-pleated-sheets to fold in space -
Answers C
Primary structure of a protein - Answers Sequence of amino acids
Secondary structure of a protein - Answers Interactions between neighboring amino acids
causing a polypeptide chain to fold and twist (alpha helix and beta pleated sheet - regional
folding)
Tertiary structure of a protein - Answers Overall-three dimensional shape of the protein (when
secondary structures fold even further)
Quaternary structure - Answers When two or more polypeptide chains associate
When codons that specify the same amino acid differ in ________, a single tRNA may be able to
anneal to several of them through wobble base pairing.
A. Any one of their nucleotides
B. Any two or their nucleotides
C. Their 5' nucleotide
D. Their middle nucleotide
E. Their 3' nucleotide - Answers E (wobble takes place on the THIRD position of a codon and the
FIRST position of the anticodon)
Where does wobble take place on the codon? (5' end or 3' end?) - Answers 3' end (third position)
Where does wobble take place on the anticodon? (5' end or 3' end?) - Answers 5' end (first
position)
Through wobble, a single __________ can pair wit more than one __________.
A. codon; anticodon
