BIO 107 FINAL EXAM STUDY GUIDE
Match the name of the bond to the description provided. Some bonds may be the
correct answer for more than one description. - Correct Answers -The bonds connecting
adjacent nucleotides in a nucleic acid: Phosphdiester bonds
The bonds connecting adjacent amino acids in a protein: Peptide bonds
The bonds holding paried bases together in opposing strands of DNA: Hydrogen bonds
The bonds stabilizing secondary structures in proteins: Hydrogen bonds
The covalent bonds linking distant cysteine amino acid residues in protein tertiary
structures: Disulfide bridges
Mark all of the levels of structure you would expect to find in a double-stranded DNA
molecule. - Correct Answers -Secondary structure
Primary structure (sequence)
What features would you expect to find in double-stranded DNA? - Correct Answers -
Helical structure, anti-parellel strands, A-T base pairing, G-C base pairing, negative
charge
What are the two features of Nucleic Acids that make them useful for storing
information? - Correct Answers -Directionality (5' to 3') and Individuality (4 different
bases in many possible combinations)
Mark all of the levels of structure you would expect to find in a protein that functions as
a complex with multiple polypeptide subunits. - Correct Answers -Quaternary structure
Secondary structure
Primary structure (sequence)
Tertiary structure
Which statement is false about the secondary structure of proteins? - Correct Answers -
The R-groups of amino acids in protein secondary structures are always hydrophobic.
Match the stage of transcription with the correct description. - Correct Answers -
Initiation: The RNA Polymerase is recruited to the front of a gene by transcription factors
at the promoter
,Elongation: The RNA polymerase adds ribonuclotides to the 3' end of RNA using the
sequence of the DNA (specifically the template strand)
Termination: The RNA polymerase leaves the DNA after interaction with a terminating
sequence/protiens
Bacteria infect bacteriophage - Correct Answers -False
The percentage of thymine nucleobases in the DNA of a cell is equal to the percentage
of adenine bases. - Correct Answers -True
Amino acid chains are used in cells as a template for RNA synthesis. - Correct Answers
-False
Transcription factors are peptides that bind to the promoter in RNA. - Correct Answers -
False
Which of the following are forms or RNA processing. - Correct Answers -5' cap
splicing
3' Poly-A Tail
Prokaryotes do not process mRNA, they just translate it while being transcribed. -
Correct Answers -True
Gene expression is regulated through control of transcription. - Correct Answers -True
5'- TAGTC TACAG GGTAC ATCCT -3'
3'- ATCAG ATGTC CCATG TAGGA -5'
If a promoter is located to the LEFT of this DNA sequence, what is the mRNA sequence
formed during transcription? - Correct Answers -5'- UAGUCUACAGGGUACAUCCU
amino group-C-Carboxyl group
|
side chain
What is this structure? - Correct Answers -amino acid
Which of the following is consistent with the Central Dogma of Molecular Biology? -
Correct Answers -DNA ==> RNA ==> protein
A neuron and a liver cell both contain the gene for the dopamine transporter, yet the
protein is only found in neurons. The main reason for this is: - Correct Answers -Only
the neurons are expressing the correct activator proteins for the dopamine transporter
gene
5'- TAGTC TACAG GGTAC ATCCT -3'
3'- ATCAG ATGTC CCATG TAGGA -5'
, If a promoter is located to the LEFT of this DNA sequence, what is the mRNA sequence
formed during transcription? - Correct Answers -5'- UAGUCUACAGGGUACAUCCU
In a skin cell, genes 2 and 4 are expressed but genes 1 and 3 are silenced. Which of
the following is consistent with this observation? Assume repressors are dominant to
activators. - Correct Answers -The triangle protein is an activator and the hexagon
protein is a repressor
Which sequence in a gene would a repressor bind to? - Correct Answers -A silencer
Which of the following statements about the genetic code is FALSE? - Correct Answers
-All combinations of 3 bases in mRNA encode for an amino acid
Which of the following would be found near the 5' end of a processed eukaryotic
mRNA? - Correct Answers -G-cap
A scientist observes in a cancer cell that no mRNA from Gene XYZ is observed in the
cytoplasm, but in a Wild Type cell there is mRNA from Gene XYZ in the cytoplasm.
Choose the change in the mutant XYZ gene that could most likely lead to this result. -
Correct Answers -The 3'- UTR (untranslated region) of the gene's mRNA is mutated
such that a poly-A tail cannot be added
A nonsense mutation in a gene: - Correct Answers -introduces a premature stop codon
into the mRNA
If the second nucleobase of a 5'-CGA-3' codon changes to an A, what type of mutation
will occur in the encoded protein? - Correct Answers -missense mutation
An insertion of four nucleotides into an exon: - Correct Answers -alters the reading
frame of the mRNA and produces a protein with a different primary structure
Proteins perform many roles in cells. Of all of the biological species we've seen thus far
in class, which of the following is NOT constructed of proteins? - Correct Answers -A
gene
During termination, which site in the ribosome is the location where a release factor will
bind to a stop codon? - Correct Answers -A site
To disrupt the primary structure of a protein, which type of intermolecular force/bond
would you need to break? - Correct Answers -Peptide bonds
RNA polymerase always begins transcription at a: - Correct Answers -Promoter
Which of the following is NOT true about RNA polymerases? - Correct Answers -They
can only add one nucleotide to a growing RNA chain before they must dissociate and
rebind to the DNA
Match the name of the bond to the description provided. Some bonds may be the
correct answer for more than one description. - Correct Answers -The bonds connecting
adjacent nucleotides in a nucleic acid: Phosphdiester bonds
The bonds connecting adjacent amino acids in a protein: Peptide bonds
The bonds holding paried bases together in opposing strands of DNA: Hydrogen bonds
The bonds stabilizing secondary structures in proteins: Hydrogen bonds
The covalent bonds linking distant cysteine amino acid residues in protein tertiary
structures: Disulfide bridges
Mark all of the levels of structure you would expect to find in a double-stranded DNA
molecule. - Correct Answers -Secondary structure
Primary structure (sequence)
What features would you expect to find in double-stranded DNA? - Correct Answers -
Helical structure, anti-parellel strands, A-T base pairing, G-C base pairing, negative
charge
What are the two features of Nucleic Acids that make them useful for storing
information? - Correct Answers -Directionality (5' to 3') and Individuality (4 different
bases in many possible combinations)
Mark all of the levels of structure you would expect to find in a protein that functions as
a complex with multiple polypeptide subunits. - Correct Answers -Quaternary structure
Secondary structure
Primary structure (sequence)
Tertiary structure
Which statement is false about the secondary structure of proteins? - Correct Answers -
The R-groups of amino acids in protein secondary structures are always hydrophobic.
Match the stage of transcription with the correct description. - Correct Answers -
Initiation: The RNA Polymerase is recruited to the front of a gene by transcription factors
at the promoter
,Elongation: The RNA polymerase adds ribonuclotides to the 3' end of RNA using the
sequence of the DNA (specifically the template strand)
Termination: The RNA polymerase leaves the DNA after interaction with a terminating
sequence/protiens
Bacteria infect bacteriophage - Correct Answers -False
The percentage of thymine nucleobases in the DNA of a cell is equal to the percentage
of adenine bases. - Correct Answers -True
Amino acid chains are used in cells as a template for RNA synthesis. - Correct Answers
-False
Transcription factors are peptides that bind to the promoter in RNA. - Correct Answers -
False
Which of the following are forms or RNA processing. - Correct Answers -5' cap
splicing
3' Poly-A Tail
Prokaryotes do not process mRNA, they just translate it while being transcribed. -
Correct Answers -True
Gene expression is regulated through control of transcription. - Correct Answers -True
5'- TAGTC TACAG GGTAC ATCCT -3'
3'- ATCAG ATGTC CCATG TAGGA -5'
If a promoter is located to the LEFT of this DNA sequence, what is the mRNA sequence
formed during transcription? - Correct Answers -5'- UAGUCUACAGGGUACAUCCU
amino group-C-Carboxyl group
|
side chain
What is this structure? - Correct Answers -amino acid
Which of the following is consistent with the Central Dogma of Molecular Biology? -
Correct Answers -DNA ==> RNA ==> protein
A neuron and a liver cell both contain the gene for the dopamine transporter, yet the
protein is only found in neurons. The main reason for this is: - Correct Answers -Only
the neurons are expressing the correct activator proteins for the dopamine transporter
gene
5'- TAGTC TACAG GGTAC ATCCT -3'
3'- ATCAG ATGTC CCATG TAGGA -5'
, If a promoter is located to the LEFT of this DNA sequence, what is the mRNA sequence
formed during transcription? - Correct Answers -5'- UAGUCUACAGGGUACAUCCU
In a skin cell, genes 2 and 4 are expressed but genes 1 and 3 are silenced. Which of
the following is consistent with this observation? Assume repressors are dominant to
activators. - Correct Answers -The triangle protein is an activator and the hexagon
protein is a repressor
Which sequence in a gene would a repressor bind to? - Correct Answers -A silencer
Which of the following statements about the genetic code is FALSE? - Correct Answers
-All combinations of 3 bases in mRNA encode for an amino acid
Which of the following would be found near the 5' end of a processed eukaryotic
mRNA? - Correct Answers -G-cap
A scientist observes in a cancer cell that no mRNA from Gene XYZ is observed in the
cytoplasm, but in a Wild Type cell there is mRNA from Gene XYZ in the cytoplasm.
Choose the change in the mutant XYZ gene that could most likely lead to this result. -
Correct Answers -The 3'- UTR (untranslated region) of the gene's mRNA is mutated
such that a poly-A tail cannot be added
A nonsense mutation in a gene: - Correct Answers -introduces a premature stop codon
into the mRNA
If the second nucleobase of a 5'-CGA-3' codon changes to an A, what type of mutation
will occur in the encoded protein? - Correct Answers -missense mutation
An insertion of four nucleotides into an exon: - Correct Answers -alters the reading
frame of the mRNA and produces a protein with a different primary structure
Proteins perform many roles in cells. Of all of the biological species we've seen thus far
in class, which of the following is NOT constructed of proteins? - Correct Answers -A
gene
During termination, which site in the ribosome is the location where a release factor will
bind to a stop codon? - Correct Answers -A site
To disrupt the primary structure of a protein, which type of intermolecular force/bond
would you need to break? - Correct Answers -Peptide bonds
RNA polymerase always begins transcription at a: - Correct Answers -Promoter
Which of the following is NOT true about RNA polymerases? - Correct Answers -They
can only add one nucleotide to a growing RNA chain before they must dissociate and
rebind to the DNA
